Molecular phylogeny of the genus Frankia and related genera and emendation of the family Frankiaceae -- Normand et al. 46 (1): 1 -- International Journal of Systematic and Evolutionary Microbiology
Bacterial strains. In this study we used eight Frankia strains, as well as unisolated nodular members of the genus Frankia and closely related actinomycetes (Table 1). The strains were grown at 28 C in F medium (Alnus-infective strains) (50), F medium containing Tween 80 (Elaeagnus-infective strains), or BAP medium (other strains) (38). DNA extraction. Total DNAs were extracted from pure cultures (48) and from actinorhizal nodules (49) and used for amplification and sequencing. PCR amplification. Double-stranded amplification was performed by using the whole rrs gene coding for 16S rRNA and a modification of the PCR procedure of Mullis and Faloona (37). The primers used to amplify the whole 16S rRNA gene that permitted subsequent cloning in a directional manner included primer FGPS5-255 (5 -TGGAAAGCTTGATCCTGGCT-3 ), which contains a HindIII restriction site, and primer FGPS1509 -153 (5 -AAGGAGGGGATCCAGCCG CA-3 ), which contains a BamHI restriction site (the restriction sites are underlined). Each PCR was performed in a 50- l (final volume) reaction mixture containing template DNA, reaction buffer (10 mM Tris-HCl [pH 8.3], 1.5 mM MgCl2, 50 M KCl, 10% [wt/vol] gelatin), each deoxynucleoside triphosphate at a concentration of 200 mM, 0.5 M oligonucleotides, and 2 U of TaqI DNA polymerase (Gibco-BRL, Cergy-Pontoise, France). In some cases, the amplification reaction was performed directly with cells resuspended in amplification buffer. The amplification reactions were performed for 35 cycles, each of which consisted of denaturation at 95 C for 1 min, annealing for 1 min at 55 C, and extension at 72 C for 2 min. To analyze the amplification products, 5 l of each reaction mixture was separated by electrophoresis on a 2% (wt/vol) agarose gel (NuSieve; FMC, Rockland, Maine). The amplified material consisted of a 1,500-bp double-stranded DNA fragment. The amplified fragments were digested with BamHI and HindIII (digestion with HindIII had to be carried out overnight since the HindIII site is close to the extremities), cloned into BamHIHindIII-cut pBluescript II SK- vector (Stratagene, La Jolla, Calif.), and transformed into Escherichia coli DH5 F (Bethesda Research Laboratories). Sequencing of DNA fragments. Five or more clones were obtained, pooled, and used in the sequencing reaction to obscure possible errors due to the Taq polymerase or to differences between copies of the gene. Below, the designations of the primers used for sequencing refer to the ``small-subunit ribosomal gene,'' the number in each designation is the coordinate of the 5 end in the Frankia sp. strain CeD homologous sequence (41) (GenBank accession number M55343), and a prime indicates that the primer is in the direction opposite transcription. Primers FGPS310-20 (GAGACACGGCCCAGACTCCT), FGPS485-292 (CAG CAGCCGCGGTAA), FGPS747-293 (AACAGGATTAGATAC), FGPS1047295 (ATGTTGGGTTAAGTC), FGPS1156-39 (GACGTCAAGTCACATGC
M55343
pdf
Analysis of the phylogenetic relationships of strains of Burkholderia solanacearum, Pseudomonas syzygii, and the blood disease bacterium of banana based on 16S rRNA gene sequences -- Taghavi et al. 46 (1): 10 -- International Journal of Systematic and Evolutionary Microbiology
PCR amplifications were performed with a Perkin-Elmer Cetus model 480 thermal cycler programmed as follows: an initial denaturation step at 96 C for 3 min, followed by 28 cycles consisting of 48 C for 1 min, 72 C for 2 min, and 93 C for 1 min, with a final extension step at 48 C for 1 min and at 72 C for 5 min to allow all extension products to be completed. The PCR products were examined by electrophoresing 5 l of each PCR product in 1% agarose gels at 4 V/cm for 10 min and then at 10 V/cm for 30 min. The PCR amplification products were visualized by staining with ethidium bromide. The remaining 95 l of each PCR product was purified by using a Promega Magic PCR Prep DNA purification kit according to the manufacturer's instructions. DNA sequencing. A Taq DyeDeoxy Terminator Cycle sequencing kit (Applied Biosystems, Foster City, Calif.) was used as recommended by the manufacturer with primers 27f, 357r, 519r, 907r, 926f, 1100r, 1114f, 1392r, 1406f, and 1525r (17), as well as primers 787r and 803f (29), to directly determine the sequences of purified PCR products. The extension products were purified by phenolchloroform extraction according to the manufacturer's instructions. The sequences of the products were determined with an Applied Biosystems model 373A DNA sequencer. Analysis of data. The 16S rDNA sequences of different strains of B. solanacearum, P. syzygii, and the BDB were manually aligned with the sequences of the type strain of B. solanacearum (strain PDDCC1727) and other species belonging to the beta subclass of the Proteobacteria by using the AE2 sequence editor (20). The evolutionary distances between sequences were computed by using the algorithm of Jukes and Cantor (15) and the DNADIST program of the PHYLIP phylogenetic analysis software package (version 3.5) (7). A dendrogram was constructed from evolutionary distance values by using the neighbor-joining method of Saitou and Nei (26) contained in the NEIGHBOR program of PHYLIP, version 3.5. The most-parsimonious tree was also constructed by using the PAUP software package (33). The topologies of the distance and parsimony trees were tested by 100 bootstrap resamplings of the data. Nucleotide sequence accession numbers. The nucleotide sequences determined in this study have been deposited in the GenBank data library under the accession numbers shown in Table 1.
U27984 U27985 U27986 U27987 U28220 U27983 U28221 U28222 U28223 U28224 U28225 U28226 U28227 U28228 U28229 U28230 U28231 U28232 U28233 U28234 U28235 U28236 U28237 U28238
pdf
Transfer of "Pseudomonas riboflavina" (Foster 1944), a gram-negative, motile rod with long-chain 3-hydroxy fatty acids, to Devosia riboflavina gen. nov., sp. nov., nom. rev [published erratum appears in Int J Syst Bacteriol 1996 Jul;46(3):839] -- Nakagawa et al. 46 (1): 16 -- International Journal of Systematic and Evolutionary Microbiology
phagemid vector pUC118 (Takara Shuzo). Escherichia coli JM109 (37) was used as the host. The single-stranded DNA used as a sequencing template was obtained after infection with bacteriophage M13KO7 (31). The plasmid was prepared by using a Miniprep protocol (14). The single-stranded DNA and cloned plasmid material were sequenced by using an AutoRead sequencing kit (Pharmacia, Uppsala, Sweden) and were analyzed with a Pharmacia A.L.F. DNA Sequencer II instrument. The 5 -fluorescein-labeled oligonucleotide primers used were M13 Universal and Reverse Primer (Pharmacia) and primer 1111R (5 -TTGCGCTCGTTGCGGGACT). Phylogenetic analysis. The 16S rRNA sequences of the strains examined and sequences of reference organisms obtained from databases were aligned with the E. coli sequence (1). The CLUSTAL V software package (10) was used to generate evolutionary distances (Knuc values [12]) and similarity values, and a phylogenetic tree was constructed by using the neighbor-joining method (22) and the Knuc values. Positions at which secondary structures varied between strains (positions 66 to 103, 179 to 220, 447 to 487, 841 to 845, 1004 to 1036, 1134 to 1140, 1247 to 1290, and 1446 to 1456) and positions at which sequences were not determined in some reference organisms (positions 1457 to 1524; E. coli numbering system) were not included in the analysis. The total number of nucleotides compared was 1,147 after we eliminated all sites at which sequences were not determined in any sequences. The topology of the phylogenetic tree was evaluated by the bootstrap resampling method of Felsenstein (6) with 1,000 replicates. Nucleotide sequence accession number. The sequence data were deposited in the DDBJ database and appear in the DDBJ, EMBL, GSDB, and NCBI nucleotide sequence databases under accession number D49423.
D49423
pdf
Rhodococcus percolatus sp. nov., a bacterium degrading 2,4,6- trichlorophenol -- Briglia et al. 46 (1): 23 -- International Journal of Systematic and Evolutionary Microbiology
Phylogenetic analysis. The Rhodococcus percolatus MBS1T 16S rDNA gene sequence was aligned manually with sequences obtained from the database of Larsen et al. (28). The R. percolatus sequence was also compared with the sequences of the actinomycetes that contain mycolic acids. Pairwise evolutionary distances (expressed as estimated numbers of changes per 100 nucleotides) were computed from percentages of similarity by using the correction of Jukes and Cantor (23). Phylogenetic trees were constructed from the distance matrices by using a least-squares algorithm (6) and the neighbor-joining method. Determination of cell surface hydrophobicity. To determine the cell surface hydrophobicity of strain MBS1T, the contact angle between a drop of demineralized H2O and a bacterial layer on a microfilter was determined in triplicate as described by Van Loosdrecht et al. (43). The cells of strain MBS1T used for these measurements were grown to the exponential and late stationary phases, and samples were prepared as described previously by Briglia et al. (3). Determination of production of biosurfactant. The release of a biosurfactant by strain MBS1T cells into the culture supernatant was assayed by using a Wilhelmy plate tensiometer. The surface tension ( ) was calculated from the equation 9.81K/2L N/m, where K was the reading given by the tensiometer during the measurement, L was the length of the platinum plate, and N/m was the force applied. Three batch cultures in mCD medium containing 1 g of sucrose per liter as a carbon source and three batch cultures containing 0.1 g of phenol or 2,4,6-TCP per liter were inoculated with approximately the same number of cells. One whole batch (40 ml) was used for each measurement, and samples were removed after 1, 2, and 3 days of incubation. Nucleotide sequence accession number. The 16S rDNA gene nucleotide sequence of R. percolatus MBS1T has been deposited in the EMBL data library under accession number X92114.
X92114
pdf
Eubacterium minutum sp. nov., isolated from human periodontal pockets -- Poco et al. 46 (1): 31 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Characterization of Legionella species by numerical analysis of whole- cell protein electrophoresis -- Verissimo et al. 46 (1): 41 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Genomic diversity and differentiation among phytoplasma strains in 16S rRNA groups I (aster yellows and related phytoplasmas) and III (X- disease and related phytoplasmas) -- Gundersen et al. 46 (1): 64 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Two coryneform bacteria isolated from the surface of French Gruyere and Beaufort cheeses are new species of the genus Brachybacterium: Brachybacterium alimentarium sp. nov. and Brachybacterium tyrofermentans sp. nov -- Schubert et al. 46 (1): 81 -- International Journal of Systematic and Evolutionary Microbiology
and the corresponding tools of the ARB (28) and PHYLIP (9) program packages, as well as the fastDNAml program (16). The compositions of the data sets varied with respect to the reference sequences and the alignment positions included. Positional variations at the individual alignment positions were determined by using the tools of the ARB package and were used as criteria to remove or include variable positions. Isolation of DNA and DNA-DNA hybridization. Chromosomal DNA was isolated from bacterial cells grown to the early stationary phase by using the method of Marmur (17). The DNA purity and concentrations of DNA were determined spectrophotometrically. DNA-DNA hybridization experiments were performed by using DNA labelled with -35S-dCTP (Amersham, Little Chalfont, United Kingdom) by nick translation (12). The hybridization experiments were performed on nitrocellulose filters in 2 SSC (1 SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.0) at 68 C for 20 h. Nonspecifically bound DNA was removed by stringent washing in 0.1 SSC containing 0.1% sodium dodecyl sulfate for 3 h at 68 C. The DNA reassociation rates were determined at the beginning of saturation (45 g of DNA) by measuring 35S contents with a scintillation counter (model MR 300; Kontron). DNA from A. globiformis DSM 20124T was used as the negative control. DNA base composition. The average guanine-plus-cytosine (G C) molar ratio of DNA was determined by the thermal denaturation method (18). Reference DNA was obtained from Micrococcus luteus DSM 20030T. Nucleotide sequence accession numbers. The nucleotide sequences of strain CNRZ 925T, strain CNRZ 926T, B. faecium DSM 4810T, B. nesterenkovii DSM 9573T, B. conglomeratum NCIMB 9859, and D. hominis DSM 7083T have been deposited in the EMBL Data Library under accession numbers X91031, X91657, X91032, X91033, X91030, and X91034, respectively.
X91031 X91657 X91032 X91033 X91030 X91034
pdf
Agromyces mediolanus sp. nov., nom. rev., comb. nov., a species for "Corynebacterium mediolanum" Mamoli 1939 and for some aniline- assimilating bacteria which contain 2,4-diaminobutyric acid in the cell wall peptidoglycan -- Suzuki et al. 46 (1): 88 -- International Journal of Systematic and Evolutionary Microbiology
AGROMYCES MEDIOLANUS SP. NOV., NOM. REV., COMB. NOV. TABLE 1. Strains used in this study and accession numbers of their 16S rDNA sequences
D45053 D45054 D45056 D45060 D45061 X77447 D45051 D45059 D45057 X77449 D45052 X77439 X77438 X77447 X77446 X77445 X77440 X77451 X77435 X77434 X77436 X77437 X77442 X77441 X77439 X77438
pdf
Phylogenetic relationships of the filamentous sulfur bacterium Thiothrix ramosa based on 16S rRNA sequence analysis -- Polz et al. 46 (1): 94 -- International Journal of Systematic and Evolutionary Microbiology
sequence was added were obtained from the Ribosomal Database Project. Sequences were chosen from previously published work and on the basis of high levels of similarity to the Thiothrix ramosa sequence by using the BLAST program (1). Initially, a larger set of sequences was used, and outgroups were removed one at a time; remaining nucleotide positions were kept if the topology of the tree did not change. The final data set included 845 nucleotide positions. Phylogenetic analyses were performed by using the distance, parsimony, and maximum-likelihood methods. Distance and bootstrap analyses were performed by using the program DNADIST with the Jukes-Cantor correction, the program SEQBOOT with 100 replicates, and the program FITCH with input randomization and global rearrangement. All of these programs are contained in the PHYLIP 3.4 package (6) and were implemented through the Genetic Data Environment (19). The parsimony analysis, including the bootstrap analysis, was performed by using PAUP 3.0 (22). For the maximum-likelihood analysis we used the fastDNAml program available from the Ribosomal Database Project. Trees were constructed by allowing jumbled addition of taxa and global rearrangement of the branches. Bootstrap values are shown if they were greater than 50%. Nucleotide sequence accession numbers and strain designations. The 16S ribosomal DNA sequence of Thiothrix ramosa has been deposited in the GenBank database under accession number U32940. The other organisms, and/or GenBank accession numbers of the other sequences used in our analysis are as follows: Bathymodiolus thermophilus symbiont, M99445; Calyptogena magnifica symbiont, M99446; clone FL5, L10936; Chromatium tepidum MCT ( ATCC type strain), M59150; Dichelobacter nodosus 198A ( ATCC 43061T) (T 27521) (reference strain), M35016; Escherichia coli, J01695; Neisseria gonorT rhoeae B5025 ( ATCC 43061T), X07714; Pseudomonas aeruginosa NIH18 ( ATCC 25330), X60783; Pseudorickettsia salmonis LF-89T ( ATCC VR 1361T), X60783; Riftia pachyptila symbiont, M99451; Solemya reidi symbiont, L07864; Thiomicrospira sp. strain L12, L01576; Thiobacillus hydrothermalis r3T ( DSM 7121T), M90662; Thyasira flexuosa symbiont, L01575; Thiothrix nivea JP2T ( ATCC 35100T [neotype strain]), M79435, M79436, and M79437; Thiomicrospira thyasiris TG2T ( DSM 5322T), L01479; and Vibrio marinus MP1 ( ATCC 15381) (source, C. R. Woese).
U32940 M99445 M99446 L10936 M59150 M35016 J01695 X07714 X60783 X60783 M99451 L07864 L01576 M90662 L01575 M79435 M79436 M79437 L01479
pdf
16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny -- Leblond-Bourget et al. 46 (1): 102 -- International Journal of Systematic and Evolutionary Microbiology
BIFIDOBACTERIUM PHYLOGENY TABLE 1. Bacterial strains and their 16S rRNA and 16S-23S ITS GenBank accession numbers
M58744 U09511 M58729 U09512 U09513 U09514 U09515 U09858 L36967 U09516 U09526 U09517 U09831 M58731 X70973 X70972 M58732 M58733 M58734 M58735 M58736 M58737 M58738 M58739 U10152 M58740 M58741 M58742 M58743 U10151 U09520 U09519 U09521 U09518 U09522 L36968 U09523 U09790 U10434 U09524 U09791 U09792 U09525 U09527 U09832 U09878 U09879 U09528 X70971 M58730 M38018
pdf
Serological and molecular characterization of Mesoplasma seiffertii strains isolated from hematophagous dipterans in France -- Gros et al. 46 (1): 112 -- International Journal of Systematic and Evolutionary Microbiology
pdf
"Candidatus comitans," a bacterium living in coculture with Chondromyces crocatus (myxobacteria) -- Jacobi et al. 46 (1): 119 -- International Journal of Systematic and Evolutionary Microbiology
RP18 column (2 by 125 mm; Macherey-Nagel); methanol was used as the eluant, and the respiratory lipoquinones were detected at 269 nm. The polar lipids were separated by two-dimensional silica gel thin-layer chromatography (catalog no. 818135; Macherey-Nagel); the gel was developed with chloroform-methanol-water (65:25:4, vol/vol/vol) in the first dimension and with chloroform-methanol-acetic acid-water (80:12:15:4, vol/vol/vol/vol) in the second dimension. The total lipids and specific functional groups were detected by using dodecmolybdophosphoric acid (total lipids), Zinzadze reagent (phosphate), ninhydrin (free amino groups), periodate-Schiff reagent ( -glycols), Dragendorff reagent (quaternary nitrogen), and anisaldehyde-sulfuric acid and alpha-naphtholsulfuric acid (glycolipids). The sphingolipids (as their free bases) were obtained by acid hydrolysis with 4 M HClmethanol (1:1, vol/vol) at 100 C for 3 h. After the solution was made alkaline with NaOH, the free bases were extracted with tert-butylmethyl ether. The N,O-bis(trimethylsilyl)acetamide derivatives were analyzed by gas chromatography by using the conditions described above. Extraction and analysis of fatty acids. Fatty acid methyl esters were obtained from freeze-dried biomass by sonification, methylation, and extraction by the method of Miller (13). The fatty acid methyl ester mixtures were separated by using a model 5898A microbial identification system (Microbial ID, Inc., Newark, Del.) (12). The following conditions were used: injection and detector port temperature, 300 C; inlet pressure, 80 kPa; split ratio, 50:1; injection volume, 1 l; and a temperature program in which the temperature increased from 130 to 310 C at a rate of 4 C/min. Determination of the DNA G C content. The methods used to determine the G C content have been described previously (12, 25). Approximately 20 g of DNA was hydrolyzed and dephosphorylated, and the nucleosides were separated by reverse-phase HPLC. The retention times of the nucleosides were determined with synthetic compounds. Nonmethylated lambda phage DNA having a G C content of 49.858 mol% (16) was used as the calibration reference. Nucleotide sequence accession numbers. The 16S rDNA nucleotide sequence which we determined has been deposited in the EMBL database under accession number X91814.
X91814
pdf
Characterization of a new obligately anaerobic thermophile, Thermoanaerobacter wiegelii sp. nov -- Cook et al. 46 (1): 123 -- International Journal of Systematic and Evolutionary Microbiology
described by Patel et al. (23). The growth rate constant for the exponential phase of growth was determined by plotting the log10 of optical density against time (26). The cellular polysaccharide content was determined by the anthrone method (32). The presence of heat-resistant endospores was demonstrated as described previously (5). Indole production, gelatin hydrolysis, and esculin hydrolysis were studied by using standard methods (32). Nucleotide sequence accession number. The 16S rDNA sequence of strain Rt8.B1T has been deposited in the EMBL database under accession number X92513.
X92513
pdf
Cutting a Gordian knot: emended classification and description of the genus Flavobacterium, emended description of the family Flavobacteriaceae, and proposal of Flavobacterium hydatis nom. nov. (basonym, Cytophaga aquatilis Strohl and Tait 1978) -- Bernardet et al. 46 (1): 128 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Characterization of the SF agent, an Ehrlichia sp. isolated from the fluke Stellantchasmus falcatus, by 16S rRNA base sequence, serological, and morphological analyses -- Wen et al. 46 (1): 149 -- International Journal of Systematic and Evolutionary Microbiology
gel (AT Biochem, Malvern, Pa.) was used for sequencing in order to determine more than 400 bases with each primer. Computer analyses of DNA sequences. The corrected levels of nucleotide divergence of 16S rRNA genes were calculated by using DNADIST from PHYLIP version 3.1 (5) with the Kimura two-parameter correction. A phylogenetic tree for the taxa studied was constructed by the neighbor-joining method (NEIGHBOR in PHYLIP) (5) on the basis of distance matrix data. Only homologous sites at which the 16S rRNA gene sequences were aligned unambiguously were included in the phylogenetic analysis. Nucleotide sequence accession numbers. The 16S rRNA nucleotide sequences used in this study were obtained from the GenBank database. The GenBank nucleotide sequence accession numbers for the organisms which we studied are as follows: Anaplasma marginale, M60313; Cowdria ruminantium, X62432; E. canis, M73221; Ehrlichia equi, M73223; E. sennetsu, M73225; E. risticii, M21290; Neorickettsia helminthoeca, U12457; Rickettsia rickettsii, U11021; Wolbachia pipientis, X61768; and SF agent, U34280.
M60313 X62432 M73221 M73223 M73225 M21290 U12457 U11021 X61768 U34280
pdf
Culture and characteristics of Helicobacter bizzozeronii, a new canine gastric Helicobacter sp [published erratum appears in Int J Syst Bacteriol 1996 Jul;46(3):839 ] -- Hanninen et al. 46 (1): 160 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Analysis of the genetic polymorphism of Borrelia burgdorferi sensu lato by multilocus enzyme electrophoresis -- Balmelli and Piffaretti 46 (1): 167 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses -- Siering and Ghiorse 46 (1): 173 -- International Journal of Systematic and Evolutionary Microbiology
(5-bromo-4-chloro-3-indolyl- -D-galactoside) per ml and 5 g of IPTG (isopropyl- -D-thiogalactoside) per ml. Plasmid DNAs isolated from white colonies were checked by performing a restriction enzyme analysis by standard procedures (42). The following strategy was used to decrease the possibility of sequencing a clone containing a Taq-induced artifact. For each strand of each 16S rRNA gene sequenced, 10 to 20 different clones were isolated. Single-stranded DNA was prepared from each of the clones, and equal amounts of the resulting single-stranded DNAs were pooled and used for sequencing. Single-stranded DNA was prepared as recommended by the plasmid manufacturer (United States Biochemical Corp.), except that phage-infected cells were grown for no more than 8 h rather than 14 to 18 h prior to harvesting. Sequencing. Single-stranded templates were sequenced by the dideoxy chain termination method of Sanger et al. (43) by using a Sequenase version 2.0 DNA sequencing kit (United States Biochemical Corp.). The DNA polymerase was prediluted in glycerol enzyme dilution buffer containing PPi; annealing and labeling with -S35-labeled dATP (Amersham Corp., Arlington Heights, Ill.) were performed as recommended by the manufacturer. Termination reactions were performed at 60 C for 5 min. In some cases, the reactions were performed with dITP as well as dGTP to relieve compression artifacts associated with G-C-rich regions of sequence. Sequencing gels were prepared and electrophoresed with glycerol-tolerant gel buffer (United States Biochemical Corp.). Standard methods were used for electrophoresis and autoradiography (42). Sequence alignment and analyses. Sequences were aligned with the most similar sequences obtained from the GenBank/EMBL and Ribosomal Database Project databases (11, 31). Sequences were retrieved from the Ribosomal Database Project in an aligned format. The sequences generated in this study were aligned manually by using conserved primary and secondary structural features, and regions where the alignment was ambiguous were not included in the phylogenetic analysis. The results of the distance matrix and parsimony methods used for phylogenetic inference were compared in order to ensure consistency in tree topology. Pairwise similarity values were determined and were converted to evolutionary distances by using the Jukes-Cantor (27), Kimura two-parameter (28), and maximum-likelihood (13) models of nucleotide substitution offered in the DNADIST program in PHYLIP version 3.5c (15). The transition-to-transversion ratio used was set at 2:1 when permitted by the program employed. Evolutionary distances were converted into dendrograms by the algorithm of Fitch and Margoliash (17) using the FITCH program in PHYLIP (15). The input order of species was randomized by using the ``J (Jumble)'' option, and 20 different input orders were analyzed. The ``G (Global)'' branch-swapping option was also used, and this option allowed us to reconsider the position of every species after the last species was added to the tree. Output data from the FITCH programs were converted into unrooted trees by using the DRAWTREE program in PHYLIP version 3.5c (15). The trees constructed from the distance matrix data were compared with the trees obtained by a parsimony method based on the Fitch model of nucleotide substitution (16) available in PAUP version 3.0s (47). A search for optimal trees was performed by using the branch-and-bound algorithm and heuristic methods in which we used stepwise addition and tree bisection and reconnection branch swapping (48); the trees obtained with the different search methods were compared. The statistical validity of the trees was investigated by the bootstrap method of numerical resampling (14) by using the SEQBOOT program in PHYLIP version 3.5c (15) and the bootstrap option in PAUP version 3.0s (47). In both cases, 200 bootstrap resamplings were performed. In addition to the Leptothrix and Sphaerotilus sequences determined in this study, sequences of representative organisms belonging to the and subgroups of the Proteobacteria in the databases (11, 31) were also included in the phylogenetic analysis. Nucleotide sequence accession numbers. The sequences determined in this study have been deposited in the Genome Sequence DataBase (GSDB) at Los Alamos National Laboratory (formerly GenBank) under the following accession numbers: ``L. discophora'' SP-6, L33974; ``L. discophora'' SS-1, L33975; L. cholodnii LMG 7171, L33979; Leptothrix sp. strain NC-1, L33981; and S. natans ATCC 15291, ATCC 29329, ATCC 29330, and ATCC 13338T (T type strain), L33976, L33977, L33978, and L33980, respectively.
L33974 L33975 L33979 L33981 L33976 L33977 L33978 L33980
pdf
Tolumonas auensis gen. nov., sp. nov., a toluene-producing bacterium from anoxic sediments of a freshwater lake -- Fischer-Romero et al. 46 (1): 183 -- International Journal of Systematic and Evolutionary Microbiology
DNA was extracted, PCR-mediated amplification of the 16S rDNA was performed, and PCR products were purified as described by De Soete (2) and Jukes and Cantor (7). The sequences of purified PCR products were determined by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Weiterstadt, Germany) as recommended by the manufacturer. Sequence reaction mixtures were separated by electrophoresis by using an Applied Biosystems model 373A DNA sequencer. The 16S rDNA sequence which was determined manually aligned with representative rDNA sequences of members of the gamma subclass of the Proteobacteria. Pairwise evolutionary distances were computed by using the correction of Jukes and Cantor (7). The least-squares distance method of De Soete (2) was used to construct a phylogenetic dendrogram from the distance matrix data. Nucleotide sequence accession number. The nucleotide sequence which we determined has been deposited in the EMBL database under accession number X92889.
X92889
pdf
Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora -- James et al. 46 (1): 189 -- International Journal of Systematic and Evolutionary Microbiology
JAMES ET AL. TABLE 1. Yeast strains used and their ITS1 and ITS2 sequence accession numbers
Z48309 Z48335 Z48310 X84640 X84640 X84640 X87129 X87129 X84732 X84732 X84642 X84642 X84642 X84642 X48347 Z48358 Z48348 Z48349 Z48350 Z48351 X84644 X84644 X84644 X84644 Z48311 Z48336 Z48312 X84641 X84641 X84641 X87130 X87130 X84733 X84733 X84643 X84643 X84643 X84643 Z48361 Z48362 Z48363 Z48365 Z48364 Z48366 X84645 X84645 X84645 X84645 X84639 X84638
pdf
Phylogenetic analysis of Butyrivibrio strains reveals three distinct groups of species within the Clostridium subphylum of the gram-positive bacteria -- Willems et al. 46 (1): 195 -- International Journal of Systematic and Evolutionary Microbiology
we also constructed a pairwise similarity matrix by repeatedly using the program GAP (6). The similarity values were converted to nucleotide substitution (Knuc) values (13), and a phylogenetic tree was drawn with the program NEIGHBOR. Nucleotide sequence accession numbers. The 16S rRNA gene sequences of B. fibrisolvens NCDO 2221T (T type strain), NCDO 2222, NCDO 2398, NCDO 2432, NCDO 2434, NCDO 2435, Bu 43, NCDO 2223, NCDO 2249, NCDO 2397, and NCDO 2399 and B. crossotus NCFB 2416T have been deposited in the EMBL data library under accession numbers X89970 to X89981.
X89970 X89981
pdf
16S rRNA gene sequence analysis relative to genomovars of Pseudomonas stutzeri and proposal of Pseudomonas balearica sp. nov -- Bennasar et al. 46 (1): 200 -- International Journal of Systematic and Evolutionary Microbiology
Strains and culture conditions. The 14 reference strains used in this study have been characterized physiologically and genomically previously (1820). These strains were originally obtained from culture collections or were isolated as indicated in Table 1. All of the strains were grown in Luria-Bertani broth (22) at 30 C with shaking and were examined to determine their maximum growth temperature (41, 44, or 46 C) and tolerance to NaCl (6, 7, 8, or 9% [wt/vol]). Isolation of genomic DNA. Cells were harvested at approximately the late exponential phase of growth by centrifugation, washed, and resuspended in 560 l of TE buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8.0]). Cells were lysed adding 0.1 mg of proteinase K (Sigma) and 30 l of 10% sodium dodecyl sulfate and incubating the resulting preparation for 1 h at 37 C. DNA was extracted by using the CTAB (hexadecyltrimethylammonium bromide) miniprep protocol for preparation of bacterial genomic DNA (27). PCR amplification of rRNA genes. The 16S ribosomal DNA was amplified by the PCR by using standard protocols (21) and a Hans Landgraf model 5.92 thermocycler as described previously (8). The forward primer, primer 16F27 (5 -AGAGTTTGATCMTGGCTCAG-3 ), annealed at positions 8 to 27, and the reverse primer, primer 16R1488 (5 -CGGTTACCTTGTTAGGACTTCACC3 ), annealed at the complement of positions 1511 to 1488 (Escherichia coli numbering [3]). Sequencing of PCR-amplified DNA. Amplified PCR products were extracted with chloroform-isoamyl alcohol (24:1) and purified with a Microcon-100 microconcentrator (Amicon). Each sample was resuspended in sterile water to a volume of 100 l, and 5 l of this preparation was used to check the quality of the PCR-amplified DNA; this was accomplished by performing electrophoresis on a 1% agarose gel with TAE and then staining the gel with ethidium bromide. The sequence of the PCR-amplified 16S ribosomal DNA was determined directly with model 373A automated DNA sequencer (Applied Biosystems, Inc.) by using the protocols recommended by the manufacturer for Taq DNA polymeraseinitiated cycle sequencing reactions with fluorescently labeled dideoxynucleotide terminators. The primers used for 16S rRNA gene sequence determinations have been described previously (9). Sequence data analysis. The sequences which we obtained were aligned with reference 16S rRNA sequences by using conserved primary sequence and secondary-structure characteristics as references (6, 28). Evolutionary distances were calculated from sequence pair comparisons as corrected (7) estimates of the average number of fixed-point substitutions per sequence position in homologous sequences since the sequences diverged. Phylogenetic trees were constructed by using subsets of data that included representative sequences of Pseudomonas spp. strains (10, 13); to do this, we used distance matrix and bootstrapped distance matrix methods as implemented in the programs of the PHYLIP (4) and ARB (26a) program packages, respectively. Nucleotide sequence accession numbers. The nucleotide sequences which we determined have been deposited in the GenBank nucleic acid sequence database under the accession numbers shown in Table 1.
U25432 U26262 U26261 U25431 U26420 U26415 U22427 U25280 U22426 U26419 U26414 U26418 U26417 U26416
pdf
Serpulina pilosicoli sp. nov., the agent of porcine intestinal spirochetosis -- Trott et al. 46 (1): 206 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Genomic variability of Staphylococcus aureus and the other coagulase- positive Staphylococcus species estimated by macrorestriction analysis using pulsed-field gel electrophoresis -- Pantucek et al. 46 (1): 216 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Spiroplasma diminutum sp. nov., from Culex annulus mosquitoes collected in Taiwan -- Williamson et al. 46 (1): 229 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Agrococcus jenensis gen. nov., sp. nov., a new genus of actinomycetes with diaminobutyric acid in the cell wall -- Groth et al. 46 (1): 234 -- International Journal of Systematic and Evolutionary Microbiology
mycolic acids were present by performing thin-layer chromatography as described by Minnikin et al. (15). DNA base composition. DNA was isolated by using a modification of the Marmur method (13). After purification by treatment with proteinase K, the DNA was degraded to nucleosides by using P1 nuclease and bovine intestinal mucosa alkaline phosphatase as described by Mesbah et al. (14). The nucleosides were separated by reversed-phase HPLC by using the HPLC system described above and the methods described by Tamaoka and Komagata (23). The G C content of the DNA was calculated from the ratio of deoxyguanosine to thymidine. 16S rDNA sequence determination. Genomic DNA was extracted, and PCRmediated amplification of the 16S rRNA genes was performed as described previously (17). Purified PCR products were sequenced directly by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.) as recommended by the manufacturer. The purified sequence reaction mixtures were electrophoresed by using an Applied Biosystems model 373A DNA sequencer. The sequence which we determined was manually aligned with previously published sequences available from public databases. Evolutionary distances calculated by the method of Jukes and Cantor (10) were used to construct a phylogenetic tree by the least-squares method of De Soete (4). Nucleotide sequence accession number. The 16S rDNA sequence of strain 2002-39/1T has been deposited in the EMBL database under accession number X92492.
X92492
pdf
Phylogenetic relationships among Rhizobium species nodulating the common bean (Phaseolus vulgaris L.) -- van Berkum et al. 46 (1): 240 -- International Journal of Systematic and Evolutionary Microbiology
measured with a scintillation counter (Packard model 2200CA Tri-Carb liquid scintillation analyzer). Each strain was analyzed twice with each probe, and the amount of radioactivity associated with each lane was determined twice. The levels of DNA relatedness between each strain and strains USDA 2370T, RCR 3644, CFN 42T, and RCR 3618D were expressed as percentages of the counts associated with the control lanes. Nucleotide sequence accession numbers. The 16S rDNA sequences of strains CFN 42T, TAL 182, USDA 2370T, RCR 3618D, and RCR 3644 have been deposited in the GenBank database under accession numbers U28916, U28939, U29386, U29387, and U29388, respectively.
U28916 U28939 U29386 U29387 U29388
pdf
Analyses of the genomes of chlamydial isolates from ruminants and pigs support the adoption of the new species Chlamydia pecorum -- Anderson et al. 46 (1): 245 -- International Journal of Systematic and Evolutionary Microbiology
50 mM KCl, 10 l of gelatin per ml, 0.045% Nonidet P-40, 0.045% Tween 20, and 0.25 U of Taq DNA polymerase (Cetus Corp., Emeryville, Calif.). Each mixture was overlaid with 50 l of light mineral oil, and 25 cycles of amplification were performed. Cycle conditions and primers for MOMP and the 60-kDa protein gene were as described by Denamur et al. (6) and Watson et al. (44), respectively. For the amplification of the 16S rRNA gene (15), the primers had the sequences GTTGAGGGAGAGTCTATGGGATATCA and TACGACACGGATAGG GTTGAGACTATCCAC. Cycle conditions were denaturation for 60 s at 94 C, primer annealing for 90 s at 36 C, and polymerization for 100 s at 72 C. The polymerization time was extended by 3 s each cycle. A 5- l aliquot of the reaction mixture was digested with the appropriate RE and analyzed by polyacrylamide gel electrophoresis (PAGE). For the cloning of the P787 MOMP gene, the coding region was amplified by using primers with the sequences GAGTATGAATTCACTCTTGAAATCGGC and TCCTTAGAATCTGAATTGAGC under conditions identical to those used for the 16S rRNA gene amplification. PAGE. Amplified DNA fragments were digested with REs, phenol extracted (35), and analyzed by PAGE followed by silver staining essentially as described by Herring et al. (16), with the exception that the gels used were 10% acrylamide and were not bonded to the plates with silane. The small fragments in the 1-kb ladder were used as size standards. Sequence analysis of the P787 MOMP gene. Sequence analysis was performed by the dideoxy method of Sanger et al. (36), using a T7 sequencing kit (Pharmacia LKB Biotechnology). The initial template was pBS plasmid containing the cloned 5 end of the P787 MOMP gene described above. Once preliminary sequence data were obtained and useful RE sites were identified, parts of the gene were subcloned into M13 bacteriophage vectors mp18 and mp19 and sequenced by using a single-stranded DNA template. The sequence was completed by cloning (using a strategy similar to that described above) and sequencing the 3 119-bp fragment from the HindIII restriction site to the end of the gene. Nucleotide sequence accession number. The PCR product from isolate P787 was cloned and sequenced, and the sequence has been deposited in the GenBank database under accession no. Z18756.
Z18756
pdf
Sutterella wadsworthensis gen. nov., sp. nov., bile-resistant microaerophilic Campylobacter gracilis-like clinical isolates -- Wexler et al. 46 (1): 252 -- International Journal of Systematic and Evolutionary Microbiology
SUTTERELLA WADSWORTHENSIS GEN. NOV., SP. NOV. TABLE 1. Isolates used and their sources and GenBank accession numbers
L37787 L37785 L37786 L37785 L37786 L37787
pdf
Nocardia pseudobrasiliensis sp. nov., a new species of Nocardia which groups bacterial strains previously identified as Nocardia brasiliensis and associated with invasive diseases -- Ruimy et al. 46 (1): 259 -- International Journal of Systematic and Evolutionary Microbiology
Values were determined by using all nucleotides that were aligned without ambiguity (see the text). The nucleotide sequence accession number for N. vaccinii ATCC 11092T is X80597.
X80597
pdf
Fervidobacterium gondwanense sp. nov., a new thermophilic anaerobic bacterium isolated from nonvolcanically heated geothermal waters of the Great Artesian Basin of Australia -- Andrews and Patel 46 (1): 265 -- International Journal of Systematic and Evolutionary Microbiology
Growth was measured spectrophotometrically and also by determining the change in pH. The fermentation end products were determined by gas-liquid chromatography. A Shimadzu model GC8 gas chromatograph equipped with a thermal conductivity detector was used for CO2 and H2 analysis. The gases were separated on a Carbosphere (80/100) column by using N2 at a flow rate of 8 ml/min as the carrier gas. A Shimadzu model GC14 gas chromatograph equipped with a flame ionization detector was used to analyze volatile fatty acids and lactate. The acids were separated on a Chromosorb 101 (80/100) column by using N2 at a flow rate of 12.5 ml/min as the carrier gas and H2 and air at flow rates of 18 and 250 ml/min, respectively, as flame gases. The oven temperature and the injector temperature were 180 and 200 C, respectively. The amounts of the gases and acids were determined as described previously (12), except that the Delta computer software analysis package (Digitals Solutions, Ltd., Brisbane, Queensland, Australia) was used to integrate the peaks. Reduction of thiosulfate, sulfite, and sulfate (final concentration, 20 mM) and reduction of sulfur (final concentration, 1%) to sulfide were performed in TYEG medium (pH 7.0) at an incubation temperature of 65 C. Sulfide production in the culture supernatant in the early stationary phase was determined as described previously (9). Light microscopy and electron microscopy. Light microscopy and electron microscopy were performed as described previously (12). G C content. DNA was isolated and purified by using a slight modification of the method of Marmur (10) in which an RNase treatment step was included after cell lysis. DNA was resuspended in 0.1 SSC (1 SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and the thermal denaturation temperature was determined with a Gilford model 250 spectrophotometer equipped with a thermoprogrammer. DNA from a reference strain of Escherichia coli (ACM 1803) (Australian Collection of Microorganisms, The University of Queensland, St. Lucia, Australia) was purified by using the procedure described above, and this DNA was used as a standard when the DNA base composition was calculated. 16S rRNA sequence studies. Partially purified DNA was used for 16S rRNA gene amplification as described previously (9, 17). The amplified 16S rRNA gene products from five 50- l tubes were pooled, electrophoresed on a 0.8% agarose gel, and purified by using QIAEX (QIAGEN GmbH, Hilden, Germany) essentially as described by the manufacturer except that the final elution of DNA was in sterile distilled water instead of Tris-EDTA buffer. The sequence was determined with an ABI automated DNA sequencer by using a Prism dideoxy terminator cycle sequencing kit and the protocols recommended by the manufacturer (Applied Biosystems, Inc.). The primers used for sequencing have been described previously (17). The 16S rRNA gene sequence which we determined was manually aligned with reference sequences of various members of the domain Bacteria by using editor ae2. Reference sequences were obtained from the Ribosomal Database Project (8) and GenBank databases. Positions of sequence and alignment uncertainty were omitted from the analysis. A phylogenetic analysis was performed by using various programs implemented as part of the PHYLIP package (4), as described below. The pairwise evolutionary distances based on 1,100 unambiguous nucleotides were determined by using the method of Jukes and Cantor (7), and dendrograms were constructed from evolutionary distances by using the neighbor-joining method. A transversion analysis was performed by using the program DNAPARS. Tree topology (determined by using 1,000 bootstrapped data sets) was reexamined by running a script consisting of the following programs: SEQBOOT, DNADIST, NEIGHBOR, and CONSENSE. A program available on TREECON (20) was also used for phylogenetic analysis. Nucleotide sequence accession number. The nucleotide sequence of the 16S rRNA gene of strain AB39T has been deposited in the EMBL database under accession number Z49117.
Z49117
pdf
Reclassification of Paenibacillus (formerly Bacillus) pulvifaciens (Nakamura 1984) Ash et al. 1994, a later subjective synonym of Paenibacillus (formerly Bacillus) larvae (White 1906) Ash et al. 1994, as a subspecies of P. larvae, with emended descriptions of P. larvae as P. larvae subsp. larvae and P. larvae subsp. pulvifaciens -- Heyndrickx et al. 46 (1): 270 -- International Journal of Systematic and Evolutionary Microbiology
X60619 X60636
pdf
Semantide- and chemotaxonomy-based analyses of some problematic phenotypic clusters of slowly growing mycobacteria, a cooperative study of the International Working Group on Mycobacterial Taxonomy -- Wayne et al. 46 (1): 280 -- International Journal of Systematic and Evolutionary Microbiology
distributed for this study included cultures that were derived from the type strains of 19 validly described species and one invalid species of mycobacteria; these cultures are identified by their species names in Fig. 1. The type strains of 13 species (M. flavescens, M. nonchromogenicum, M. triviale, M. terrae, M. marinum, M. szulgai, M. kansasii, M. gastri, M. gordonae, M. shimoidei, M. farcinogenes, M. xenopi, and M. tuberculosis) exhibited phenetic matching scores of less than 85% with all of the test strains used in this study. The remaining type strains exhibited phenetic matching scores of more than 85% with at least one other culture in the study set. RNA studies. When the slowly growing test strains were examined in laboratory P, 29 different nucleotide sequence patterns were observed in 146-nucleotide signature region A of the 16S rRNA, and 15 patterns were observed in 96-nucleotide signature region B. (Two strains in the study were rapid growers and were excluded from further study.) The sequences of some of the strains were identical in region A but different in region B, and the converse was also true. One strain that was representative of each of the composite nucleotide sequence patterns (i.e., the patterns in regions A and B combined) was selected for an expanded sequence determination study (as described in Materials and Methods), and the resulting data were used to generate phylogenetic trees based on the patterns of most of the slow growers (Fig. 2) and of a subset that included members of the M. avium-M. intracellulare complex (Fig. 3). Two strains that represented the type strains of two rapidly growing species, M. flavescens and M. farcinogenes, were not included on these phylogenetic trees. The European Molecular Biology Laboratory accession numbers of the 16S rRNA sequences of most of the type strains
X88917 X88918 X88920 X88919 X88921 X88916 X88912 X88911 X88907 X88914 X88915 X88909 X88910 X88913 X88908 X88906
pdf
Spirochaeta alkalica sp. nov., Spirochaeta africana sp. nov., and Spirochaeta asiatica sp. nov., alkaliphilic anaerobes from the Continental Soda Lakes in Central Asia and the East African Rift -- Zhilina et al. 46 (1): 305 -- International Journal of Systematic and Evolutionary Microbiology
glucose, as no decomposition in the alkalic medium was observed after autoclaving at 110 C for 30 min. Cultures were incubated at 37 C in an N2 atmosphere. Routine transfers were performed with Bellco glass tubes and rubber-stoppered screw-cap flasks by a standard strictly anaerobic technique. Growth was recorded by optical density measurements at 600 nm in Bellco glass tubes using a photometer (Spekol, Jena, Germany) with the tube adapter ER. Analytical procedures. Volatile products of glucose fermentation were quantified by using a Chrom-5 gas chromatograph equipped with a flame ionization detector, using argon as a carrier gas and a Chromosorb 101 column (0.9 m by 3 mm) at 160 C. Lactate was identified by using a lactate dehydrogenase test kit (Boehringer Mannheim). Gaseous products were determined in an LHM-80 gas chromatograph with a catarometer using argon as a carrier gas and a molecularsieve 5A column (0.75 m by 3 mm) at ambient temperature. Glucose was quantified by phenol-H2SO4 reaction (11). Microscopy. The morphology of the living cultures was observed with an anoptral Reichardt Zetopan microscope. Electron microscopy. Negative staining by phosphotungstate was performed after fixation with glutaraldehyde added to the culture at a final concentration of 2.5% (vol/vol). Cells were centrifuged, resuspended in tap water, and stained with 1% (wt/vol) phosphotungstate (pH 7). For ultrathin sectioning, cells were prefixed with glutaraldehyde in culture medium for 30 min at ambient temperature. The cells were centrifuged, washed once with 0.15 M K-phosphate buffer (pH 7.2) with 3% (wt/vol) NaCl, and centrifuged, and the pellet was fixed with 1% (vol/vol) OsO4 in acetate-Veronal buffer (pH 7.2) with 3% (wt/vol) NaCl for 18 h at 4 C. Dehydration and embedding in Epon 812 were done by standard methods. Microscopy was done with a JEM-100C microscope. Genome characterization. DNA was isolated and purified from lysozyme- and sodium dodecyl sulfate-treated cells by the method of Marmur (16). The G C content was determined by a thermal denaturation method (17). Escherichia coli K-12 DNA was used as a standard. DNA-DNA hybridization was carried out by optical reassociation as described by De Ley et al. (4). The genome size was determined according to an equation in reference 9. 16S rRNA sequencing. Genomic DNAs were extracted from the three strains and the genes coding for 16S rRNA (16S rDNAs) were amplified as described previously (21). PCR products were sequenced directly by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems) according to the manufacturer's instructions. The purified sequence reaction products were electrophoresed by using an Applied Biosystems model 373A DNA sequencer. The sequences determined in this study were manually aligned with previously published sequences of representatives of the spirochetes. Pairwise evolutionary distances were computed by the correction of Jukes and Cantor (15). Phylogenetic analyses were carried out by using the algorithm of De Soete (5). Nucleotide sequence accession number. The almost complete ( 95% of the E. coli sequence) 16S rDNA sequences were determined for the three strains described here. The sequences have been deposited in the EMBL database under the following accession numbers: S. asiatica, X93926; S. alkalica, X93927; and S. africana, X93928.
X93926 X93927 X93928
pdf
A reconsideration of species related to Saccharomyces dairensis (Naganishi) -- Vaughan-Martini and Barcaccia 46 (1): 313 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Arbitrarily primed PCR analysis of Mycoplasma hyopneumoniae field isolates demonstrates genetic heterogeneity -- Artiushin and Minion 46 (1): 324 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Species-specific sequences at the omp2 locus of Brucella type strains -- Ficht et al. 46 (1): 329 -- International Journal of Systematic and Evolutionary Microbiology
Veterinary Pathobiology and Texas A&M University and Texas Agricultural Experiment Station, College Station, Texas 77843,1 and Cairo University, Cairo, Egypt2 A DNA sequence analysis of the omp2 locus of Brucella type strains revealed nucleotide differences that can be used for species identification. We developed specific probes which were used to verify the observed differences among the type strains following PCR amplification of portions of the omp2 locus. Organisms belonging to the genus Brucella are typically identified by using phenotypic properties which have been shown to vary among isolates (3, 5, 12). Previously, workers in several laboratories have shown that there are species-specific restriction fragment length polymorphisms which can be used to identify members of the genus Brucella (2, 4, 6, 8, 13). The results of genetic analyses have suggested that the Brucella species (Brucella abortus, Brucella melitensis, Brucella suis, Brucella ovis, Brucella canis, and Brucella neotomae) represent a monospecific genus or a genomic species (15). In this study we extended our previous work in order to characterize oligonucleotide probes which can be used to identify individual Brucella species on the basis of DNA sequence variations at the omp2 locus. Five overlapping portions of the omp2 locus of Brucella type strains were amplified by using the primers shown in Table 1 and selected by using Oligo 4.0 (National Biosciences, Inc.) on the basis of a previously published sequence available from the GenBank database (accession number M26034). Amplified segments of the omp2 locus from three separate amplification reactions were cloned into plasmid pCR or pBluescript, and the sequence of at least one recombinant from each reaction mixture was determined as described previously by using internal primers and vector sequencing primers supplied by manufacturers (7). The sequences shown in Table 2 have been deposited in the GenBank database. The results of an analysis of the sequences obtained for the omp2 locus for the type strains confirmed that the gene duplication in a 3,400-bp region was conserved in all six species. Variations in nucleotides were observed at 183 positions in a 3,400-bp region representing 6% of the locus; this number does not include variations due to insertions or deletions of blocks of nucleotides (the total number of changes was approximately 185 bp). One of the deletions was a block of 138 nucleotides from the central region of the omp2a gene in B. abortus biovars 1, 2, and 4 (7). The mechanism for removing this sequence may involve imperfect direct repeats of 26 nucleotides 5 to both deletion endpoints in the omp2a gene in all Brucella taxa except B. abortus biovars 1, 2, and 4. This sequence can form cruciform structures up to 9 bp long which may represent recognition sites for DNA cleavage (1). Although found in these three organisms, the deletion may have occurred independently in them and should not be used by itself to infer a close relationship. This deletion preserves the original open reading frame, expression from this locus in porin-deficient Escherichia coli results in altered membrane permeability (10), and the purified protein forms pores in black lipid bilayers (9). When we compared the sequences of the omp2a and omp2b genes obtained from all of the species, we also found a deletion in each omp2b gene that corresponded to the 5 copy of the direct repeat. It seems reasonable to assume that if this sequence represents a site for homologous or site-specific recombination events, this feature could result in deletion within the active porin gene and is not compatible with survival. A phylogenetic analysis of the omp2 nucleotide sequences of the type strains of Brucella species was performed by using the computer program PAUP (14). The resulting cladogram is the single most parsimonious representation of the relationships among these species (Fig. 1). This tree is similar to the traditional trees obtained for these species when phenotypic analysis is used. For example, B. abortus and B. melitensis have long been considered closely related on the basis of phenotypic characteristics, and they formed a distinct monophyletic group when their nucleotide sequences at the omp2 locus were studied. In addition, also because of phenotypic similarities, it has been postulated that B. canis and B. suis are recently diverged and closely related species (11). The results of our analysis of the omp2 gene region strongly suggest that these two species are sister taxa that share a common ancestor that is not shared with the other Brucella species. Phenotypically, B. neotomae and B. ovis are very different from the other Brucella species, and these two species were the most divergent taxa in our study on the basis of their omp2 nucleotide sequences. The extreme divergence of B. ovis from the other Brucella species is the result of a lack of divergence between its omp2a and omp2b gene sequences. When the omp2a and omp2b genes of most species are aligned, similar numbers of nucleotide differences (average, 130 differences) are observed in the two gene copies. The exception is B. ovis, in which the genes differ by only 30 nucleotides at the 3 ends of the genes. The sequence differences are similar to the differences observed in other species. The 5 ends of the two genes are identical, and the sequences in these regions correspond to the sequences found in the omp2a genes of other species. This suggests that either the progenitor gene closely resembled omp2a or gene conversion corrected the 5 end of the omp2b gene in B. ovis by using omp2a as the template. Similarly, the genes in B. neotomae differ at only 112 positions. At the other 28 positions (all at the 3 end) the sequences are identical and correspond to the profile obtained for omp2a, once again suggesting that the omp2a gene was used to correct sequence variation within
M26034
pdf
Classification of the genus Mobiluncus based on comparative partial 16S rRNA gene analysis -- Tiveljung et al. 46 (1): 332 -- International Journal of Systematic and Evolutionary Microbiology
ever, the conflicting genotypic and phenotypic results add a further argument to the discussion whether 16S rRNA gene sequences alone provide enough information to distinguish M. curtisii subspecies (5, 10, 16). Fohn et al. (4) raised a series of monoclonal antibodies to M. curtisii subsp. curtisii and M. mulieris and found that at a 1/50 dilution of the culture fluids these antibodies could distinguish between M. curtisii subsp. curtisii and M. curtisii subsp. holmesii. These findings are not consistent with those of Påhlson et al., who were not able to distinguish between M. curtisii subsp. curtisii and M. curtisii subsp. holmesii with a set of monoclonal antibodies (11). No taxonomic conclusion can be drawn from the findings of Fohn et al. (4) since dilution experiment data are not reported for the various monoclonal antibodies. On the basis of DNA hybridization data and G C contents, Christiansen et al. suggested that the more homologous long curved rods (LCR) (M. mulieris) is a distinct species, but the more heterologous short curved rods (SCR) (M. curtisii) should be separated into several species (3). However, these authors felt that these species designations should be supported by biochemical and serological evidence. Several investigators have described the phenotypic complexity of the genus Mobiluncus and have characterized several atypical Mobiluncus strains (3, 6, 12, 18). Spiegel stated that the differences are due mainly to differences in the media and methods used, as well as to normal strain variation (14). However, when partial 16S rDNA sequences were examined, no differences between M. curtisii subsp. curtisii and M. curtisii subsp. holmesii sequences were found. These results are not consistent with the previously described division of M. curtisii strains into subspecies, which was based on biochemical and serological results. Nucleotide sequence accession numbers. Partial DNA sequences derived from broad-range amplified 16S rRNA genes have been deposited in the European Molecular Biology Laboratory Data Library under the following accession numbers: M. mulieris ATCC 35243T, X82602; M. curtisii subsp. curtisii ATCC 35241T, X82603; M. curtisii subsp. holmesii ATCC 35242T, X82604; Mobiluncus sp. strain A294, X82605; Mobiluncus sp. strain A345, X82606; Mobiluncus sp. strain A543, X82607; and atypical Mobiluncus sp. strain 0960, X82608. Partial DNA sequences derived from Mobiluncus-specific amplified 16S rRNA genes have been deposited under the following accession numbers: M. mulieris ATCC 35243T, X86004; M. curtisii subsp. curtisii ATCC 35241T, X86005; and M. curtisii subsp. holmesii ATCC 35242T, X86006.
X82602 X82603 X82604 X82605 X82606 X82607 X82608 X86004 X86005 X86006
pdf
Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev., designation of ATCC 334 as the neotype of L. casei subsp. casei, and rejection of the name Lactobacillus paracasei -- Dicks et al. 46 (1): 337 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation -- Wang et al. 46 (1): 341 -- International Journal of Systematic and Evolutionary Microbiology
Microbiology Division, National Center for Toxicological Research, Food and Drug Administration, Jefferson, Arkansas 72079 In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence of F. prausnitzii in the GenBank database (accession number M58682). A PCR assay based on the new sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium ``clusters III and IV'' (M. D. Collins, P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow, Int. J. Syst. Bacteriol. 44:812826, 1994). Fusobacterium prausnitzii is one of the most common organisms in human gastrointestinal tracts. In previous studies it was found that F. prausnitzii accounted for more than 7% of the human fecal microflora and ranked second in relative frequency among bacterial species isolated from human feces (6, 7). Fusobacterium spp. are anaerobic, gram-negative, straight, curved, or helical rod-shaped organisms which belong to the family Bacteroidaceae (7). Lawson et al. (4) investigated the phylogenetic relationships of 14 members of the genus Fusobacterium, but F. prausnitzii was not included in this study. Neefs et al. (8) described a taxonomic classification of all Fusobacterium species based on the results of a comparison of their small-subunit rRNA sequences. These authors found that on their bacterial subtree the Fusobacterium spp. did not belong to any cluster, and therefore these organisms were listed separately in a group designated ``Fusobacterium and relatives.'' All Fusobacterium species except F. prausnitzii were listed as members of this group, and F. prausnitzii was listed as a member of a group that contained gram-positive organisms and their relatives which have high G C contents (8). Nicholson et al. (9) reported that the results of an analysis of 16S rRNA sequences indicated that F. prausnitzii is more closely related to the gram-positive organisms Propionibacterium acnes and Actinomyces israelii than to Fusobacterium spp. These authors pointed out that this independent finding is consistent with the findings of Neefs et al.; the 16S rRNA sequence of F. prausnitzii used in this study was the sequence deposited in the GenBank database under accession number M58682. We have been developing molecular methods to monitor intestinal microflora to study the effects of food additives, xenobiotic compounds, and pharmaceutical drugs on the human colonic microflora (10). In a study to develop a PCR method for detection of F. prausnitzii in human feces, the 16S rRNA gene sequence deposited in the GenBank database (accession number M58682) was used first. We designed a pair of PCR primers on the basis of this sequence. The sequence of forward primer oFPR-1 is GCTTTTGTGGGGGCTGAGT (base positions 82 to 100), and the sequence of reverse primer oFPR-2 is CTGATAAGCCGCGAGTCCA (base positions 246 to 228). When we used this primer set, we did not obtain positive PCR results with either F. prausnitzii ATCC 27766 or F. prausnitzii ATCC 27768. We wondered if the sequence deposited in the GenBank database might be incorrect; therefore, we partially sequenced the 16S rRNA gene of F. prausnitzii ATCC 27768 and designed a new set of PCR primers on the basis of the resulting sequence information. The sequence of forward primer FPR-1 was AGATGGCCTCGCGTCCGA (base positions 222 to 239), and the sequence of reverse primer FPR-2 was CCGAAGACCTTCTTCCTCC (base positions 420 to 402). PCR assays in which we used this primer set gave positive results with F. prausnitzii ATCC 27766 and ATCC 27768. In addition, after reviewing the results of the studies of Neefs et al. (8) and Nicholson et al. (9), we decided that the entire 16S rRNA gene sequence of F. prausnitzii ATCC 27766 should be determined. Amplification and sequencing of the 16S rRNA gene. A 1.5-ml pure culture of F. prausnitzii was centrifuged to pellet the bacterial cells. The cells were washed twice with phosphate-buffered saline (PBS) and once with autoclaved distilled water and then resuspended in 0.1 ml of distilled water. The cells (10 l) were diluted 1:10 with 90 l of 1% Triton X-100, heated at 100 C for 5 min, immediately cooled in ice water, and then subjected to PCR amplification without isolating the DNA. A 3.5- l portion of each sample was added to 45 l of a PCR mixture containing 50 mM Tris-HCl (pH 8.5), 20 mM KCl, 3 mM MgCl2, 0.05% bovine serum albumin (catalog no. A-4378; Sigma Chemical Co., St. Louis, Mo.), 0.25 mM dATP, 0.25 mM dTTP, 0.25 mM dCTP, 0.25 mM dGTP, each primer at a concentration of 0.25 M, and 1.8 U of Taq polymerase. The PCR was performed in a Perkin-Elmer model 480 thermal cycler. The following program was used: one cycle consisting of 95 C for 3 min, followed by 35 cycles consisting of 95 C for 20 s, 55 C for 20 s, and 74 C for 60 s, and finally one cycle consisting of 74 C for 3 min and 25 C for 5 s. The PCR products were separated by electrophoresis in a 1% agarose gel containing ethidium bromide. The DNA band (about 1.5 kb) was excised from the agarose gel under a long-wave UV lamp. The Glassmilk method (Geneclean II kit; Bio 101, Inc., La Jolla, Calif.) was used to recover the DNA as recommended by
M58682 M58682 M58682
pdf
Candidatus Microthrix parvicella, a filamentous bacterium from activated sludge sewage treatment plants -- Blackall et al. 46 (1): 344 -- International Journal of Systematic and Evolutionary Microbiology
X82546 X89774 X89560 X89561 X82546
pdf
The phylogeny of Methanopyrus kandleri -- Rivera and Lake 46 (1): 348 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Molecular and chemical taxonomic differentiation of Candida boidinii Ramirez strains -- Lin et al. 46 (1): 352 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Sulfolobus hakonensis sp. nov., a novel species of acidothermophilic archaeon -- Takayanagi et al. 46 (2): 377 -- International Journal of Systematic and Evolutionary Microbiology
Tris-HCl (pH 7.5) and centrifuged at 10,000 g for 1 min and then spread onto a water surface, as described previously (28). Intact or broken cells, cell membrane fragments, and cell ghosts floating on the surface were picked up with carbon-coated grids and stained with 1.0% uranyl acetate; they were then observed by electron microscopy directly or after rotary shadowing with Pt-Pd (4:1) at an angle of tan1 (1/10), as described by Marmur (19). Determination of the G C content. Genomic DNA was isolated from microorganisms as described previously (19). The guanine-plus-cytosine (G C) content of the DNA was determined by CsCl isopycnic centrifugation by using a type 70PRS rotor (Hitachi Koki Co., Ltd., Hitachi, Japan) at 40,000 rpm for 72 h, as described by De Ley (3). The distribution of DNA in the fraction was determined by the method of Kissane and Robins (15). E. coli IAM 1264 DNA (G C content, 51.6 mol%) was used as the standard in the buoyant density analysis. Lipid analysis. Total lipids were extracted from wet cells (packed volume, 1 ml) with 4.0 ml of chloroform-methanol-water (1:2:0.5, vol/vol/vol) with sonication. The extraction procedure was repeated three times. After degradation of the total lipids with acid methanolysis as described by Furuya et al. (8), the lipid cores were separated by thin-layer chromatography (TLC) on silica gel plates (type HPTLC; catalog no. 5641; Merck, Rahway, N.J.). The spots on the TLC plates were visualized by spraying the plates with 50% H2SO4 and then heating them at 140 C for 10 min. A quantitative analysis of the spots on the TLC plates was performed by a TLC-densitometry procedure by using a chromatoscanner (model CS-930; Shimadzu, Kyoto, Japan). DNA-DNA hybridization. DNA was isolated from microorganisms as described by Marmur (19). The DNA was labeled with [3H]dTMP by nick translation by using a nick translation kit (Takara Shuzo Co., Ltd., Kyoto, Japan), and 0.1 g of the resulting labeled, sonicated DNA was the probe used for hybridization. After denaturation of the DNA, 10 g of unlabeled DNA was immobilized on a nitrocellulose membrane (type HAWP; pore size, 0.45 m; Millipore, Bedford, Mass.), and DNA-DNA hybridization experiments were performed by the membrane filter method, as described by Suzuki et al. (27). 16S rRNA sequencing. RNA was extracted from microorganisms, and complete sequences of the 16S rRNA were determined by the reverse transcriptase method (17). The following nucleotide primers that were complementary to universally conserved regions were used: TCCGGTTGATCCTGCCGGA (position 10, forward direction), GCGGACGGCTGAGTAACA (position 120, forward direction), CCTATAACGGGTAGGGGCCG (position 290, forward direction), CTACGGGGCGCACCAG (position 350, forward direction), CAGCCGCCGCGGTAATAC (position 520, forward direction), GGTACTCC CGGAGTAGGGGC (position 700, forward direction), GATTAGATACCCTG GTAG (position 800, forward direction), AAACTTAAAGGAATTGGC (position 920, forward direction), GTTAAGTCAGGCAACGAGCG (position 1110, forward direction), CACGCGGGTTACAATGGC (position 1240, forward direction), CCTTGCACACACCGCCCGTC (position 1240, forward direction), TGTTACTCAGCCGTCCGC (position 120, reverse direction), CGGCCCCT ACCCGTTATAGG (position 290, reverse direction), CTGGTGCGGCCC CGTAG (position 350, reverse direction), GTATTACCGCGGCGGCTG(position 520, reverse direction), GCCCCTACTCCGGGAGTACC (position 700, reverse direction), CTACCAGGGTATCTAATC (position 800, reverse direction), GCCAATTCCTTTAAGTTT (position 920, reverse direction), CGCTCGTTGCCTGACTTAAC (position 1110, reverse direction), GCCATTG TAACCCGCGTG (position 1240, reverse direction), GACGGGCGGTGTGTG CAAGG (position 1400, reverse direction), and GAGGTGATCCAGCCGC AGG (position 1540, reverse direction) (E. coli 16S rRNA numbering). These primers were made with DNA synthesizer (model 380B; Applied Biosystems, Foster City, Calif.). Levels of homology and phylogenetic distances were determined by the method of Kimura (14). A phylogenetic tree was reconstructed by using the algorithm of the neighbor-joining method (22) and the phylogenetic distance values. The statistical significance of the positions of some groups on the tree was reexamined by using the bootstrap method of Felsenstein (7) and 1,000 replicates. Nucleotide sequence accession numbers. The 16S rRNA nucleotide sequences of strain HO1-1 and S. acidocaldarius DSM 639T have been deposited in the DDBJ, EMBL, and GenBank databases under accession numbers D14052 and D14053, respectively.
D14052 D14053
pdf
Thermus oshimai sp. nov., isolated from hot springs in Portugal, Iceland, and the Azores, and comment on the concept of a limited geographical distribution of Thermus species -- Williams et al. 46 (2): 403 -- International Journal of Systematic and Evolutionary Microbiology
HB8T (14) with other 16S rRNA sequences revealed that the genus Thermus is related to the green nonsulfur bacteria, the second deepest bacterial branch point after the Thermotoga maritima branch point. Many 16S rRNA and 16S rDNA sequences of Thermus strains are now available (10, 40, 52) (GenBank accession numbers L09660 to L09672). The sequences of the 16S rDNA genes of Thermus ruber, Thermus brockianus YS38T, and strains Vi7 and SPS14 (10) confirmed the conclusion based on DNA-DNA homology data that the yellow-pigmented Thermus strains are closely related to each other but not to Thermus ruber (42). The lower ``thermophilic bias'' that was evident in the sequence of the Thermus ruber gene, which was associated with the lower growth temperature of this organism compared with the yellow-pigmented strains, was important in confirming the relationship between the thermophilic genus Thermus and the mesophilic genus Deinococcus (10). The sequences of the 16S rDNA genes of Thermus aquaticus YT1T, ``Thermus flavus'' AT62, Thermus sp. strains HSA1, OK6A1, Rt41A, T351, Tok8A1, Tok20A1, and ZHGIA1, Thermus filiformis Wai33A1T, and Thermus ruber were determined by Saul et al. (40) and have been deposited in the GenBank data base. When these sequences were aligned with those of Thermus aquaticus YS25 and YS52 (unpublished sequences determined at the Deutsche Sammlung von Mikroorganismen for R. J. Sharp), Thermus thermophilus HB8T (14, 15) and HB27 (GenBank accession number L09659), Thermus brockianus YS38T, and strains Vi7 and SPS17T (10), it was found that the regions that include helices 6, 10, and 18 (Table 4) vary from species to species. The variations show that 16S rRNA sequences may be used to identify species. These data support the hypothesis that the geographical distribution of Thermus species may not be as restricted as has been thought. The sequence of strain HSA1 (isolated in the South Island of New Zealand [16]) is very similar to the sequences of Thermus thermophilus HB8T and ``Thermus flavus'' from Japan. Thermus thermophilus strains are known to occur in widely separated areas, including Icelandic terrestrial (47) and marine hot springs (23) and Sao Miguel in the Azores. The 16S rDNA sequence of ZHGIA1, which was isolated in Iceland (18), indicates that this strain belongs to the species Thermus brockianus, which was found (53) among strains obtained from Yellowstone National Park in the United States (27). Similarly, the sequence of the 16S rDNA gene of isolate NMX2A1 from New Mexico (19) indicates that this organism is similar to the Vizela strains from Portugal and Sao Miguel Island in the Azores, which themselves belong to a species whose strains have been isolated from sources in Britain, the United States, and Iceland. The concept of a circumscribed geographical distribution of Thermus species may therefore be more apparent than real. Clearly, there may be unknown chemical and physical reasons why a particular species may thrive in one spring but not in another. It seems likely that the use of 16S rDNA sequences and species-specific probes for the 16S rDNA gene with large collections of isolates should throw light on the true distribution of Thermus species and also should allow the occurrence of these organisms to be correlated with the results of physical and chemical analyses of hot spring waters. The 16S rDNA sequences currently available for Thermus species have recently been tabulated to assist in the design of species-specific probes (52). Description of Thermus oshimai sp. nov. Thermus oshimai (osh i.ma.i. N.L. adj. oshimai, referring to T. Oshima, a prolific researcher who has studied the molecular biology of the genus Thermus). Aerobic, heterotrophic, thermophilic short rods that are gram negative. Thermus oshimai forms a yellow pigment
L09660 L09672 L09659
pdf
Isolation, phenotypic characterization, and phylogenetic position of a novel, facultatively autotrophic, moderately thermophilic bacterium, Thiobacillus thermosulfatus sp. nov -- Shooner et al. 46 (2): 409 -- International Journal of Systematic and Evolutionary Microbiology
Thiobacillus perometabolis. The GenBank accession number for the complete
Institut National de la Recherche Scientifique (INRS-Eau), Universite du Quebec, Sainte-Foy, Quebec G1V 4C7,1 ´ ´ ´ and Centre de Recherche en Biologie Forestiere, Universite Laval, Sainte-Foy, ` ´ Quebec G1K 7P4,2 Canada ´ Thiobacillus thermosulfatus ATCC 51520T (T type strain) was isolated from sewage sludge samples enriched with elemental sulfur. The cells of this organism were gram negative, rod shaped, motile, facultatively autotrophic, and strictly aerobic and contained polyphosphate inclusions and polyhedral bodies. During growth on thiosulfate, the following intermediates were produced: tetrathionate, trithionate, and sulfate, and the pH was lowered from neutrality to around 2.5. Autotrophic growth was observed at pH values between 4.3 and 7.8 and at temperatures of 34 to 65 C; optimum growth occurred at pH 5.2 to 5.6 and 50 to 52.5 C. Ubiquinone Q8 was present in the respiratory chain. The DNA contained 61 1 mol% G C. No denitrification was observed under autotrophic and heterotrophic conditions. The cells produced a glycocalyx during growth in the presence of S0. As determined by a 16S rRNA gene sequence analysis, T. thermosulfatus is a distinct species that belongs to the beta subdivision of the Proteobacteria and is closely related phylogenetically to Thiobacillus perometabolis. The GenBank accession number for the complete 16S rRNA gene sequence of T. thermosulfatus is U27839. According to Kelly and Harrison (17) in Bergey's Manual of Systematic Bacteriology, the only criterion for grouping all of the Thiobacillus species in one genus is that all of these organisms are rod-shaped eubacteria that obtain energy for autotrophic growth from oxidizing inorganic sulfur-containing substrates. Consequently, this genus comprises species that have different pH, temperature, and nutrient requirements. In fact, it includes organisms that are acidophilic, organisms that are neutrophilic, organisms that are thermophilic, denitrifiers, and facultative heterotrophs (19). When temperature requirements are considered, the following three Thiobacillus species are recognized as moderately thermophilic organisms: Thiobacillus tepidarius, Thiobacillus aquaesulis, and Thiobacillus caldus (33 35). A Thiobacillus-like moderately thermophilic bacterium was also partially characterized by Williams and Hoare (32). The great phenotypic diversity of the thiobacilli is supported by the results of genetic analyses. The first phylogenetic study of sulfur- and iron-oxidizing eubacteria placed members of the genus Thiobacillus in three of the four subdivisions of the Proteobacteria (21, 27). A phylogenetic analysis of 16S rRNA gene sequences revealed that most members of the genus Thiobacillus belonged to the beta subdivision, but some strains were more closely related to other genera that are not iron or sulfur oxidizers (21). In fact, this study revealed that Thiobacillus acidophilus and Thiobacillus versutus were members of the alpha subdivision. Moreover, Thiobacillus acidophilus was closely linked to the genus Acidiphilium, suggesting that this organism should not be included in the genus Thiobacillus. The species Thiobacillus versutus and two other hydrothermal vent isolates were described as members of a new genus, and Thiobacillus ferrooxidans M-1 and Thiobacillus thyasiris were classified as members of the gamma subdivision. Recently, Thiobacillus versutus and Thiobacillus thyasiris have been reclassified as Paracoccus versutus (13) and Thiomicrospira thyasirae, respectively (9, 36). These two taxonomic reclassifications have clarified the phylogenetic cohesion of the genus Thiobacillus, because almost all of the Thiobacillus species now belong to the beta subdivision of the Proteobacteria. The description of additional species should help define the phenotypic and phylogenetic limits of the genus Thiobacillus. During the development phase of a new bioleaching technology, a bacterium that was able to oxidize elemental sulfur under thermophilic conditions was isolated from municipal wastewater treatment plant sludge samples (24, 25). In this paper we describe the isolation and the genotypic and phenotypic characteristics of this new thermophilic colorless sulfur bacterium, Thiobacillus thermosulfatus sp. nov. MATERIALS AND METHODS
U27839
pdf
A phylogenetic analysis of Borrelia burgdorferi sensu lato isolates associated with Lyme disease in Japan by flagellin gene sequence determination -- Fukunaga and Koreki 46 (2): 416 -- International Journal of Systematic and Evolutionary Microbiology
synthesized primers FLF1 (5 -TAA CGG CAC ATA CTC AGA TGC AGA CAG AGG-3 ), FLF2 (5 -GGA TGA GGC AAT TGC TGT CAA TAT TTA TGC-3 ), FLR1 (5 -GTC TAT TTT GGA AAG CAC CTA AAT TTG CTC-3 ), and FLR2 (5 -GCA TTT GGT TGT ATT GAG CCT GAT C-3 ). Sequence alignment, similarity matrix construction, and phylogenetic tree construction were performed with a Macintosh personal computer by using the DNASTAR program (DNASTAR, Inc., Madison, Wis.) and the CLUSTAL V software package (19). Nucleotide sequence accession numbers. The flagellin gene nucleotide sequences of B. burgdorferi sensu lato isolates which we determined in this study have been assigned the following Genome Sequence Data Base, DNA Data Base of Japan, European Bioinformatics Institute, and National Center for Biotechnology Information accession numbers: D63363 (B. garinii HT17), D63364 (B. type strain]), D63366 (B. afzelii garinii JEM4), D63365 (B. afzelii VS461T [T HT61), D63367 (ribotype group IV strain HT22), D63368 (ribotype group IV strain HT7), D63369 (ribotype group IV strain HT37), D63370 (ribotype group IV strain JEM5), D63371 (ribotype group V strain HT19), D63372 (ribotype group V strain JEM3), D63373 (ribotype group VI strain HT55), and D63374 (ribotype group VI strain N337). The accession numbers of the flagellin gene sequences of strains published previously (18, 23, 34, 36) that were compared in this study are as follows: B. burgdorferi sensu stricto type strain B31, X16833; strain GeHo, X56334; B. garinii Ip90, X75203; B. afzelii ACA1, X75202; Borrelia hermsii HS1, M33839; B. burgdorferi KL10, L42881; and B. burgdorferi NBSlab, L42876.
D63363 D63364 D63366 D63365 D63367 D63368 D63369 D63370 D63371 D63372 D63373 D63374 X16833 X56334 X75203 X75202 M33839 L42881 L42876
pdf
Thermothrix azorensis sp. nov., an obligately chemolithoautotrophic, sulfur-oxidizing, thermophilic bacterium -- Odintsova et al. 46 (2): 422 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Tsukamurella pulmonis sp. nov -- Yassin et al. 46 (2): 429 -- International Journal of Systematic and Evolutionary Microbiology
Nucleotide sequence accession number. The 16S rDNA sequence of strain IMMIB D-1321T is available from the EMBL data library under accession number X92981.
X92981
pdf
Lactobacillus panis sp. nov., from sourdough with a long fermentation period -- Wiese et al. 46 (2): 449 -- International Journal of Systematic and Evolutionary Microbiology
Plasmid assay. The plasmid contents of the new strains were determined by using the miniprep method described by O'Sullivan and Klaenhammer (14). For cell lysis, the use of mutanolysin was crucial. Plasmid size was estimated by comparing the relative running distances obtained with the running distances of the plasmids of Lactococcus lactis DSM 4643, which were used as standards. Agarose gels were stained with SYBR Green I (Molecular Probes, Inc., MoBiTec, Gottingen, Germany) instead of ethidium bromide by following the man¨ ufacturer's instructions. Nucleotide sequence accession numbers. The 16S rDNA sequences of strains DSM 6035T and DSM 4864T have been deposited in the EMBL database under accession numbers X94230 and X94229, respectively.
X94230 X94229
pdf
Reclassification of a polycyclic aromatic hydrocarbon-metabolizing bacterium, Beijerinckia sp. strain B1, as Sphingomonas yanoikuyae by fatty acid analysis, protein pattern analysis, DNA-DNA hybridization, and 16S ribosomal DNA sequencing -- Khan et al. 46 (2): 466 -- International Journal of Systematic and Evolutionary Microbiology
(Perkin-Elmer Cetus Corp., Norwalk, Conn.). The PCR cycle parameters were as follows: preheating for 3 min at 95 C, denaturation for 20 s at 95 C, annealing for 20 s at 55 C, and extension for 60 s at 74 C. After 35 cycles, the final step was incubation for 3 min at 74 C. The lengths of the amplified fragments were determined by electrophoresis in an agarose (1%, wt/vol) gel containing ethidium bromide in TAE buffer (13). Sequence determination. Amplification primers Amp-1 and Amp-2 were also used as sequencing primers with eight other sequencing primers; U2, RU2, U3, RU3, U6, RU6, U7, and RU7, which are located in the internal conserved regions of the 16S rRNA gene sequence. The primer sequences and their locations were described previously (21). The amplified DNA (about 1.5 kb) was visualized with a longwave UV lamp and excised from the agarose gel. The Glassmilk method (Geneclean II kit; Bio 101, Inc., La Jolla, Calif.) was used to recover the DNA. Direct sequencing of the PCR products was done with the SequiTherm Cycle Sequencing Kit (Epicentre Technologies, Madison, Wis.) with [35S]dATP. Phylogenetic analysis. The 16S rRNA gene sequence of Beijerinckia sp. strain B1 was compared with those of other, related species available from GenBank. Homology analysis and rooted tree construction were conducted by using the MegAlign computer program (DNASTAR Inc., Madison, Wis.). Nucleotide sequence accession number. The nucleotide sequence of the 16S rRNA gene of strain B1 has been deposited in the GenBank (EMBL) database under accession number X85023.
X85023
pdf
Bacillus vallismortis sp. nov., a close relative of Bacillus subtilis, isolated from soil in Death Valley, California -- Roberts et al. 46 (2): 470 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Phylogenetic analysis of Streptomyces spp. causing potato scab based on 16S rRNA sequences -- Takeuchi et al. 46 (2): 476 -- International Journal of Systematic and Evolutionary Microbiology
sponding to positions 883 to 902, and 5 -TTTCACACAGGAAACAGCTATGA CAGAAAGGAGGTGATCCAGCC-3 , corresponding to positions 1509 to 1528, or 5 -CACGTCCTTCATCGGTTCCTGGTGCC-3 , corresponding to the complement of positions 35 to 60 of 23S rRNA (the underlined portions of the primers correspond to the sequences of Cy5-labeled primers). PCR amplification of the target sequence was performed in a 50- l (total volume) reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1.5 mM MgCl2 each deoxynucleoside triphosphate at a concentration of 200 M, 5 pmol of each primer, 2.5 l of template, and 2.5 U of Taq polymerase (TOYOBO). PCR was performed with a model 480 DNA thermal cycler (Perkin-Elmer Cetus) by using the following protocol: initial denaturation at 95 C for 2.5 min, followed by 35 cycles consisting of denaturation at 95 C for 1 min, annealing at 55 C for 1 min, and extension at 72 C for 2 min, and an additional extension step consisting of 72 C for 10 min. One primer of each set of primers was biotinylated, the biotinylated PCR products were immobilized on streptavidin-coated paramagnetic beads (Dynabeads M-280 streptavidin; DYNAL), and single-stranded DNA templates were prepared by following the manufacturer's instructions. Both strands were then sequenced directly by cycle sequencing by using an ALFred autocycle sequencing kit (Pharmacia Biotech) and the following Cy5-labeled primers: primer ALFred M13-40 (5 -CGCCAGGGTTT TCCCAGTCACGAC-3 ) and reverse primer ALFred M13 (5 -TTTCACACAG GAAACAGCTATGAC-3 ). The sequencing products were loaded onto a 6% polyacrylamide gel, and separation was monitored on-line with an ALFred DNA sequencer (Pharmacia Biotech). Phylogenetic analysis. The sequences of the 16S rRNAs of S. griseus subsp. griseus (11), S. ambofaciens (17), S. lividans (26), and S. coelicolor (2) were obtained from the EMBL and GenBank databases for comparison. The genetic distances between sequences were estimated by using Knuc values (12). A phylogenetic tree was constructed by the neighbor-joining method (19). Nucleotide sequence accession numbers. The sequences of the strains investigated in this study have been deposited in the GenBank, EMBL, and DDBJ (DNA Data Base of Japan, Mishima, Japan) under the following accession numbers: D63862 for ATCC 49173T, D63863 for ATCC 33282, D63864 for SNS-26, D63865 for ATCC 49003T, D63866 for 91-Sy-13, D63867 for ATCC 12309T, D63868 for ATCC 25435T, D63869 for ATCC 27449T, D63870 for ATCC 14975T, D63871 for ATCC 25495T, D63872 for ATCC 25497T, and D63873 for ATCC 19812T.
D63862 D63863 D63864 D63865 D63866 D63867 D63868 D63869 D63870 D63871 D63872 D63873
pdf
Phylogenetic analysis of Acinetobacter strains based on the nucleotide sequences of gyrB genes and on the amino acid sequences of their products -- Yamamoto and Harayama 46 (2): 506 -- International Journal of Systematic and Evolutionary Microbiology
FIG. 1. Amino acid sequence alignment of the gyrB products of 15 Acinetobacter strains. Amino acids identical to those in the genomic species 1 (A. calcoaceticus CIP 81.08T) sequence are indicated with dots. (A) Sequence alignment for the N-terminal region of the amplified fragment corresponds to positions 107 to 223 of the E. coli K-12 sequence (accession number P06982). (B) Sequence alignment for the C-terminal region corresponds to positions 394 to 493 of the E. coli K-12 sequence.
P06982
pdf
VOL. 46, 1996 TABLE 1. Yeast strains compared in this study and their small-subunit rRNA gene sequence accession numbers
M83264 M55638 M55639 M63096 M94337 X83828 X83816 X83818 X83815 X83814 X60179 X53497 X51831 M60304 X78601 M60303 M55528 D14593 M60307 M55527 M60309 M55526 M92991 L05428 D12801 X83819 X58053 X83821 X83820 X58052 X83817 X85110 U00969 U00974 X69841 M83258 D12804 X69842 Z49753 X69844 X89520 X89519 X89521 X89518 X83823 X83822 X51830 X83824 X89524 X89523 X89522 X89525 X83825 X89526 X89527 X83826 X89528 L36659 D12805 X53499 X78600 X69846 D12802 Z27393 M60310 X58054 X58055 Z27408 X12708 X60180 X83827 X84326 D13459 D12806 M27607 X69843 X69847 D01174 Z32848 X54866 X54865 M59760 L22261 X60181 U00971 D14165 D12531 M92990 X53496 X84639 X84638 X60182 Z49754 U00973 X62396 X69848 M60312 X91083 X91084 X91085 X77930 X91086 X90755 X90756 X90757 X90758
pdf
Bifidobacterium inopinatum sp. nov. and Bifidobacterium denticolens sp. nov., two new species isolated from human dental caries -- Crociani et al. 46 (2): 564 -- International Journal of Systematic and Evolutionary Microbiology
pdf
High-resolution genotypic analysis of the genus Aeromonas by AFLP fingerprinting -- Huys et al. 46 (2): 572 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Characterization of lactobacilli by Southern-type hybridization with a Lactobacillus plantarum pyrDFE probe -- Bringel et al. 46 (2): 588 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Rickettsia africae sp. nov., the etiological agent of African tick bite fever -- Kelly et al. 46 (2): 611 -- International Journal of Systematic and Evolutionary Microbiology
Type strain. The type strain of R. africae is strain Z9-Hu, an isolate obtained from a person with tick bite fever; this strain has been deposited in the Collection of the World Health Organization Collaborative Center for Rickettsial Reference, Marseille, France. Nucleotide sequence accession number. The 16S rRNA gene sequence of R. africae Z9-HuT has been deposited in the GenBank data library under accession number L36098.
L36098
pdf
Stability in and harmonization of bionomenclature -- Hawksworth 46 (2): 619 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Validation of the publication of new names and new combinations previously effectively published outside the IJSB -- 46 (2): 625 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Legionella waltersii sp. nov. and an unnamed Legionella genomospecies isolated from water in Australia -- Benson et al. 46 (3): 631 -- International Journal of Systematic and Evolutionary Microbiology
pdf
The differentiation of Bordetella parapertussis and Bordetella bronchiseptica from humans and animals as determined by DNA polymorphism mediated by two different insertion sequence elements suggests their phylogenetic relationship -- van der Zee et al. 46 (3): 640 -- International Journal of Systematic and Evolutionary Microbiology
responding to positions 797 to 777 and 93 to 113 on the sequence of IS1002a, respectively (Fig. 2). To isolate DNA, bacterial cells were scraped from agar plates and suspended in a physiological salt solution supplemented with 1 mM EDTA. The preparations were diluted to an optical density at 600 nm of 2 10 5 and boiled for 10 min to release the DNA, and 5 l of each suspension was used in a PCR. The PCR conditions used have been described previously (26). The reaction mixtures were preheated at 95 C for 3 min. A total of 33 amplification cycles consisting of 1 min at 95 C, 1 min at 54 C, and 1 min at 72 C were performed with a DNA thermocycler (Perkin-Elmer Cetus); this was followed by incubation at 5 min at 72 C to complete the final polymerase reaction. DNA sequence analysis. The sequences of 420-bp DNA fragments of IS1001 amplified by primers A and Z were compared by using PCR products derived from the following strains: one Dutch B. parapertussis isolate obtained from a human, two B. parapertussis ovine isolates (from Scotland and New Zealand), three B. bronchiseptica isolates obtained from pigs (from The Netherlands, the United States, and Australia), and two isolates obtained from rabbits (from Denmark and Switzerland). The sequences of the PCR fragments were determined as described by Craxton (7) by using with dye-labeled dideoxynucleotides, primers A and Z, and a model 370 automated sequencer (Applied Biosystems). The sequences of plasmid clones containing IS1002 sequences were determined in both directions by using Taq polymerase (Promega), dye-labeled M13 primers or dye-labeled dideoxynucleotides, and primers P3, HG1, H, HG2, C, and H2 as described above. To investigate whether IS481 had been inserted into IS1002, the sequence of the downstream flanking region of IS481 was determined by using primer S23 (5 -GGCGCGCTGTACCCATCTCC-3 ), corresponding to positions 989 to 1009 on the IS481 sequence (19). Searches for sequence similarity were carried out with the BLAST algorithm (1). Nucleotide sequence accession number. The IS1002 sequence has been deposited in the EMBL databank under accession number Z54268.
Z54268
pdf
Actinobacillus delphinicola sp. nov., a new member of the family Pasteurellaceae Pohl (1979) 1981 isolated from sea mammals -- Foster et al. 46 (3): 648 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Samples. All of the cetaceans examined were reported under the Scottish Strandings Scheme and were located around the Scottish coastline. Postmortem examinations were carried out in accordance with a nationally agreed protocol (8). Selected tissues were removed for bacteriological investigation. Isolation and cultivation. Primary isolations were made on Columbia agar (Difco, East Molesey, United Kingdom) supplemented with 5% citrated sheep blood (CSBA) that was incubated at 37 C in an atmosphere containing 10% CO2 for 48 h. The sources of the strains which we investigated are shown in Table 1. Characterization tests. Isolates were routinely grown on CSBA to provide inocula for biochemical tests; the one exception was the cultures used for the catalase test, for which tryptone soya agar (Difco) supplemented with 1% glucose was used. In the catalase test 3% H2O2 was pipetted onto a culture, and the culture was examined both immediately and after 5 min for the formation of gas bubbles. The oxidase test was performed by moistening a filter paper disk (diameter, 7 cm) in a petri dish with 2 or 3 drops of 1% N,N,N ,N -tetramethyl-pphenylenediamine dihydrochloride (Fisons Scientific Equipment, Loughborough, United Kingdom). A small amount of a culture was smeared across the filter paper with a platinum loop, and the occurrence of a purple reaction within 30 s was considered a positive result. The effects of different atmospheres on growth were determined by using CSBA incubated at 37 C in air without added CO2 and prereduced CSBA incubated at 37 C in an anaerobic chamber. The ability to grow at 22, 30, and 42 C was determined on CSBA. We also tested for growth on Columbia agar supplemented with 5% serum, Columbia agar without blood or serum added, and MacConkey agar with and without salt (Difco). Xand V-factor requirements were determined on nutrient agar. Tests for oxidation or fermentation of glucose were performed with API OF medium (Biomerieux, ´ Basingstoke, United Kingdom) and marine OF medium (10). OF medium supplemented with 2% serum and OF medium supplemented with 0.1% yeast extract were also inoculated and incubated. Acid production from carbohydrates was determined in 1% peptone watersugar media prepared with 1% Bacto Peptone (Difco), 0.5% NaCl (Merck, Poole, United Kingdom), 1% Andrade's indicator, and carbohydrate (Merck) at a concentration of 1%, as described by Cowan and Steel (1). From a CSBA culture, a concentrated cell suspension was prepared in 0.5 ml of peptone water-sugar medium for each carbohydrate, and the preparations were incubated in a water bath at 37 C for 24 h. Arginine dihydrolase, ornithine decarboxylase, and lysine decarboxylase test media prepared by the method of Møller (11) and urea broth (Oxoid, Basingstoke, United Kingdom) were inoculated with concentrated culture suspensions, and the resulting preparations were incubated in a water bath at 37 C for 24 h. Strains were also examined with the API 20E, API 20NE, and API ZYM systems by using the manufacturer's instructions. API 20NE strips were also set up with a McFarland standard 4 inoculum. The API ZYM reactions were scored as 0, 1, 2, 3, 4, or 5 on the basis of the results of a comparison with the color chart of the manufacturer; scores of 3, 4, or 5 were considered strong positive reactions, and scores of 1 or 2 were considered weak positive reactions. Determination of 16S rRNA gene sequences. DNA was isolated by a standard minipreparation method described by Lawson et al. (9). A large fragment of the 16S rRNA gene was amplified by PCR by using universal primers pA (positions 8 to 28 [Escherichia coli numbering]) and pH* (positions 1542 to 1522). The amplified product was sequenced directly by using primers for conserved regions of the rRNA and a Sequenase version 2.0 sequencing kit (United States Biochemical Corp., Cleveland, Ohio) as described by Hutson et al. (7). The sequences which we determined and the sequences of members of the Haemophilus-Pasteurella complex obtained from the EMBL Data Library were aligned by using the program PILEUP (2), and the alignment was corrected manually. A distance matrix was produced by using the program DNADIST (and the Kimura-2 parameter) of the PHYLIP package (5), and a tree was constructed by the neighbor-joining method with the program NEIGHBOR of the same package. The stability of the groups was assessed by bootstrapping by using the programs SEQBOOT, DNADIST, NEIGHBOR, and CONSENSE (5). Nucleotide sequence accession numbers. The nucleotide sequences of representative 16S rRNA genes which we determined have been deposited in EMBL Data Library under the following accession numbers: strain M1063/93L, X89377; type strain), X89378; strain M39/94, X89380; and strain strain M906/93T (T M266/94, X89381.
X89377 X89378 X89380 X89381
pdf
Phylogenetic analysis reveals new relationships among members of the genera Microtetraspora and Microbispora -- Wang et al. 46 (3): 658 -- International Journal of Systematic and Evolutionary Microbiology
FIG. 1. Phylogenetic relationships among Actinomadura, Microtetraspora, Microbispora, and Streptosporangium species. The phylogenetic tree was generated by using a maximum-parsimony method (25) with gaps treated as a fifth base. When the gaps were excluded, the overall topology of the tree was not affected, except that the branch lengths were slightly different (data not shown). The numbers at nodes are bootstrap values (based on 100 resamplings). The bar represents one inferred substitution per 100 nucleotides. A phylogenetic tree having a similar topology was generated by using the Saitou-Nei (21) neighbor-joining method (data not shown). The 16S rRNA sequences of the following Streptomyces, Sacchrothrix, and Actinoplanes species were obtained from the EMBL database: Streptomyces galbus (accession number X793240), Sacchrothrix longispora (X76964), Sacchrothrix mutabilis (X76966), Actinoplanes utahensis (X80823), and Actinoplanes philippinensis (X72864). Abbreviations: A., Actinomadura; Mb., Microbispora; Mt., Microtetraspora; S., Streptosporangium.
X79324 X76964 X76966 X80823 X72864
pdf
Phenotypic and genotypic characterization of atypical Lactococcus garvieae strains isolated from water buffalos with subclinical mastitis and confirmation of L. garvieae as a senior subjective synonym of Enterococcus seriolicida -- Teixeira et al. 46 (3): 664 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Comparative analysis of 16S and 23S rRNA sequences of Listeria species -- Sallen et al. 46 (3): 669 -- International Journal of Systematic and Evolutionary Microbiology
TABLE 1. Origins and EMBL accession numbers of complete 23S rDNA sequences of the Listeria type strains analyzed in this study
X92948 X92952 X92949 X92950 X92951 X92953 X92954
pdf
Polyphasic approach to the classification and identification of Gardnerella vaginalis and unidentified Gardnerella vaginalis-like coryneforms present in bacterial vaginosis -- van Esbroeck et al. 46 (3): 675 -- International Journal of Systematic and Evolutionary Microbiology
harvested, and the fatty acid methyl esters were extracted, separated, and identified as described previously (46). Determination and analysis of 16S rRNA gene sequences. Genomic DNA was prepared by the standard procedures described by Giesendorf et al. (19). The 16S rRNA genes were amplified by PCR (32, 41), using a Perkin-Elmer Cetus GeneAmp PCR System 9600 apparatus. PCR was performed with forward primer 16F27 (annealing at positions 8 to 27) and reverse primer 16R1525 (annealing at the complement of positions 1525 to 1541; Escherichia coli 16S rRNA gene sequence numbering). The reaction conditions were the same as those described previously (25). PCR products were purified by using Centricon100 microconcentrators (Amicon GmbH, Witten, Germany), and the sequence of the amplified 16S ribosomal DNA was determined directly by using an Applied Biosystems model 373A DNA sequencer and the protocols of the manufacturer (Perkin-Elmer, Applied Biosystems GmbH, Weiterstadt, Germany) for Taq cycle sequencing with fluorescent dye-labeled dideoxynucleotides. The sequencing primers which we used have been described previously (27). The sequence data which we obtained were aligned with previously described 16S rRNA (and rRNA gene) sequences (9, 34) by using conserved regions and secondary-structure characteristics as references (21, 48). Sequence similarity values and evolutionary distances, which incorporated a correction factor (24) for reverse mutations, were calculated for masked (27) and unmasked sequence pair comparisons by using unambiguous nucleotide positions. Phenotypic characterization. A total of 27 strains, including 17 cluster I strains (see below) which represented the diversity of this cluster, as determined by cellular protein and fatty acid analyses, and all 10 cluster II strains (see below), were examined by using Rapid ID 32 Strep and API Coryne galleries (bioMerieux, La Balme-les-Grottes, Montalieu-Vercieu, France), as described by the ´ manufacturer. In addition, 13 cluster I strains and all of the cluster II strains were analyzed by using experimental API galleries that included tests for 59 peptidases, 10 esterases (tests performed with all strains except strains LMG 14331 and ITG 131), and 20 glycosidases (tests performed with all strains except strains LMG 14331, ITG 131, ITG 296, ITG 806, ITG 886, and ITG 900). The presence of fructose-6-phosphate phosphoketolase activity (42) in the same 13 cluster I strains and all of the cluster II strains was verified. Nucleotide sequence accession number. The 16S ribosomal DNA sequence of strain LMG 14331, a representative of protein electrophoretic cluster II (see below), has been deposited in the GenBank database under accession number X87133.
X87133
pdf
Mycobacterium hodleri sp. nov., a new member of the fast-growing mycobacteria capable of degrading polycyclic aromatic hydrocarbons -- Kleespies et al. 46 (3): 683 -- International Journal of Systematic and Evolutionary Microbiology
28 C. Fatty acid methyl esters were prepared from 40 mg (wet weight) of cells as described previously (26), with minor modifications (19). The analyses were performed by using a model 5898A gas chromatograph (Hewlett-Packard Co.) connected to a 486 Vectra computer (Hewlett-Packard Co.). The Microbial Identification System software (Microbial ID, Newark, Del.) was used to control the system and to identify the fatty acids. The Microbial Identification System Library for mycobacteria was used to identify the mycobacterium on the basis of its fatty acids. Extraction and analysis of mycolic acids. The mycolic acids of 50 mg of freeze-dried bacteria were analyzed as described previously (22, 27). Analysis of 16S rDNA. Extraction of genomic DNAs and amplification of the 16S rDNAs of strain EMI2T, M. austroafricanum ATCC 33464T, and Mycobacterium parafortuitum DSM 43528T were carried out as described previously (31). PCR products were sequenced directly by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.) and the manufacturer's protocol. The sequence reaction mixtures were electrophoresed by using an Applied Biosystems model 373A DNA sequencer. Phylogenetic analysis. The 16S rDNA sequences which we determined were compared with 16S rDNA database for members of the order Actinomycetales consisting of the sequences deposited in the Ribosomal Database Project database (23). In order to compensate for multiple substitutions at any given site in the sequence, similarity values were corrected by the method of Jukes and Cantor (10). Dendrograms were constructed by the neighbor-joining method (4) and the distance matrix method of De Soete (2) by using the corrected dissimilarity values. To calculate bootstrap values, we analyzed 200 trees. Nucleotide sequence accession numbers. The sequences of the type strains of M. austroafricanum and M. parafortuitum and strain EMI2T have been deposited in the EMBL data library under accession numbers X93182, X93183, and X93184, respectively.
X93182 X93183 X93184
pdf
Paenibacillus apiarius sp. nov -- Nakamura 46 (3): 688 -- International Journal of Systematic and Evolutionary Microbiology
The Agricultural Research Service Culture Collection (NRRL) at the National Center for Agricultural Utilization Research maintains these strains. Each NRRL designation includes the prefix B-, which designates strains acquired directly from individuals or strains isolated at the National Center for Agricultural Utilization Research, or the prefix NRS-, which designates strains obtained from the Bacillus collection of N. R. Smith deposited in the Agricultural Research Service Culture Collection by R. E. Gordon. Working stock cultures were incubated at 28 C on nutrient agar amended with 5 mg of MnSO4 H2O per liter until sporulation occurred and then were stored at 4 C. DNA isolation, G C contents, and DNA reassociation. The organisms used for DNA isolation were grown to the mid- to late-logarithmic phase (where microscopic examination showed an absence of sporulation) in TGY broth (6) at 28 C on a rotary shaker (200 rpm), and the cells were harvested by centrifugation at 5 C. DNA was extracted and purified by a modification of the method of Marmur (13). The modification entailed the use of CsCl gradient ultracentrifugation to purify the DNA preparations (12). Consistent values of 1.8 to 1.9 and 2.0 to 2.3 for the ratios of A260 to A280 and the ratios of A260 to A230, respectively, confirmed the high quality of each DNA preparation. Melting curves showing hyperchromicities ranging from 38 to 40% (14) corroborated the absorbance ratio observations. In a previous publication (14), the protocol used for spectrophotometric estimation of the extent of DNA reassociation was described. The extent of reassociation was calculated by the equation of De Ley et al. (4). The U.C. Cluster procedure of the PC-SAS version (SAS Institute, Inc., Cary, N.C.) facilitated computer-aided clustering of DNA relatedness data based on an unweighted pair group arithmetic average algorithm (19). SAS/GRAPH, in which the SAS macro GRAFTREE written and provided by Dan Jacobs, University of Maryland, was used, permitted computer-aided generation of dendrograms. 16S rRNA gene sequencing. A 16S rRNA gene DNA fragment of strain NRRL NRS-1438T (T type strain) that corresponds to positions 9 to 1510 of Escherichia coli 16S rRNA was amplified by PCR, using purified DNA and a primer combination consisting of 5 -AGAGTTTGATCCTGGCTCAG-3 (forward primer 27f [10]) and 5 -TACGG(CT)TACCTTGTTACGACTT-3 (reverse primer 1492r [10]). The amplification products were purified with a GENECLEAN II kit (Bio 101, La Jolla, Calif.) and were sequenced with a Prism ABI dideoxy terminator cycle sequencing kit manufactured by Applied Biosystems, Ltd. The protocols used were those recommended by the manufacturer. Sequences were determined with the automated Applied Biosystems DNA sequencer. The following primers cited by Lane (10) were used for sequence analyses: primers 27f, 530f, 1114f, 1406f, 109rl, 342r, 685r3, 907r, 1100r, and 1492r. In addition, two other primers, designated as 304f (5 -GTAGCCGAC CTGAGAGG-3 ) and 801f (5 -AACAGGATTAGATACCC-3 ), were designed to obtain unambiguous results. The CLUSTAL V (7) program was used to align the 16S rRNA gene DNA sequence generated with sequences of selected members of the family Bacillaceae obtained from GenBank (11). A similarity matrix was constructed from the aligned sequences. Pairwise evolutionary distances were computed from the similarity data by applying the Olsen correction parameter (15) of Jukes and Cantor (8). Preliminary relationships were determined by the neighbor-joining method of Saitou and Nei (16) and the DNA parsimony algorithm, using the DNAPARS program. The parsimony analysis revealed six equally parsimonious best trees. The robustness of the topologies was evaluated by bootstrap analysis (SEQBOOT program) through 100 bootstrap replications. The DNAML program was used to generate a maximum-likelihood tree (see Fig. 2) to which bootstrap values of more than 60% were applied. The DNAPARS, SEQBOOT, and DNAML programs are part of the PHYLIP, version 3.55c, software package (J. Felsenstein, University of Washington, Seattle). Characterization. Strain characterization was carried out as described previously (5, 14). Whole-cell fatty acid profiles were determined by the MIDI system of Sasser (17). Nucleotide sequence accession number. The GenBank accession number for the NRRL NRS-1438T 16S rRNA gene DNA sequence is U49247.
U49247
pdf
Two new leptospiral serovars in the Hebdomadis serogroup isolated from Zimbabwe cattle -- Feresu et al. 46 (3): 694 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Bartonella vinsonii subsp. berkhoffii subsp. nov., isolated from dogs; Bartonella vinsonii subsp. vinsonii; and emended description of Bartonella vinsonii -- Kordick et al. 46 (3): 704 -- International Journal of Systematic and Evolutionary Microbiology
a previously described protocol (3). The template DNA used for direct sequencing of isolate G7464 was produced by enzymatic amplification of the 16S rRNA gene, using primers fD1 and rD1, as described by Weisburg et al. (31), and methods described by Daly et al. (7). PCR products were purified by using Dynabead M280 streptavidin-coated magnetic beads (Dynal, Inc., Great Neck, N.Y.) and the modification of the method of Hultman et al. (13) described previously (7). Ten oligonucleotides described by Stackebrandt and Charfreitag (27) were used as sequencing primers for the eluted strand, and reverse complementary oligonucleotides to these 10 oligonucleotides were used to sequence the bound strand. 16S rRNA sequence analysis. All of the 16S rRNA sequences used in this study were retrieved electronically from the GenBank database (5, 8). In the case of 93-C01T sequence alignment was performed by using the Genetic Data Environment (24) and a Sun Sparcstation II (Sun Microsystems, Mountain View, Calif.). Sequence data for G7464 were aligned by using the multisequence alignment program PILEUP, which is part of the Genetics Computer Group (Madison, Wis.) software package (8). The alignment was masked to remove variable regions where the nucleotide alignment could not be reliably determined. Phylogenetic relationships were inferred from the data by using version 3.5c of the PHYLIP software package (10). Evolutionary distance values determined by the method of Jukes and Cantor (14) were used to calculate rRNA similarity values and to construct a dendrogram by the neighbor-joining method (21). The reliability of the tree was analyzed by bootstrapping the data (9). Nucleotide sequence accession numbers. The 16S rRNA gene sequence of strain 93-C01T has been deposited in the GenBank, EMBL, and DDBJ databases under accession number L35052. The 16S rRNA sequence of strain G7464 has been deposited in the GenBank database under accession number U26258.
L35052 U26258
pdf
Desulfovibrio gabonensis sp. nov., a new moderately halophilic sulfate- reducing bacterium isolated from an oil pipeline -- Tardy-Jacquenod et al. 46 (3): 710 -- International Journal of Systematic and Evolutionary Microbiology
PHYLIP package of software programs (14). The tree topology was reexamined by using 100 bootstrapped data sets. Nucleotide sequence accession numbers. The sequences of the 16S rRNA genes of strain SEBR 2840T, Desulfohalobium retbaense, and Desulfovibrio halophilus have been deposited in the GenBank and EMBL databases under accession numbers U31080, U48244, and U48243, respectively.
U31080 U48244 U48243
pdf
Mycoplasma sturni sp. nov., from the conjunctiva of a European starling (Sturnus vulgaris) -- Forsyth et al. 46 (3): 716 -- International Journal of Systematic and Evolutionary Microbiology
kit (Pharmacia Biotech., Inc., Piscataway, N.J.) and an automated laser fluorescence ALF DNA sequencer (Pharmacia). Homology searches were accomplished by using BLAST (1) and FASTA (GCG) with nonredundant nucleotide databases. Nucleotide sequence accession number. The nucleotide sequence of the strain UCMFT 16S rRNA gene determined in this study has been deposited in the GenBank database under accession number U22013.
U22013
pdf
Phylogeny and taxonomy of mesophilic Methanococcus spp. and comparison of rRNA, DNA hybridization, and phenotypic methods -- Keswani et al. 46 (3): 727 -- International Journal of Systematic and Evolutionary Microbiology
(Escherichia coli numbering; 3 of rRNA) were as follows: position 473, 5 CTTTCCCTCGCGGTA; position 791, 5 -ATTGGCCTTTCTCCCCT; position 1617, 5 -GTGTCGGTTCTGGGTACG; position 2591, 5 -GGTCTAAAC CCTG; and position 2760, 5 -CTTAGATGCTTTCAGC. The sequences of the 16S rRNA primers used and the positions of the complimentary regions (E. coli numbering as described by Brosius et al. [5]) were as follows: position 520, 5 -ACCGCGGCTGCTGGC; position 920, 5 -ATTCCTTTAAGTTTCA; and position 1400, 5 -ACGGGCGGTGTGTGC. The other 16S rRNA primers used have been described by Rouviere et al. (35). Data analysis. Sequences were aligned by using the program "pileup" contained in Genetics Computer Group sequence analysis package V.7.01 (10) and a VAX computer. Previously published sequences of M. vannielii, M. voltaei, M. thermolithotrophicus, M. igneus, M. jannaschii, and Methanobacterium formicicum rRNAs were obtained from Woese et al. (47). The aligned sequences were edited to remove the gaps, and all positions that had undetermined nucleotides in any sequence were excluded from the subsequent analysis. This alignment was used in the Genetics Computer Group "distance" program for computing similarity matrices (uncorrected). Pairwise evolutionary distances were calculated with Kimura's two-parameter model (which assumes that transitions and transversions occur at different rates) by using the default transition/transversion ratio of 2 and the same alignment with the DNAdist program of the PHYLIP package, version 3.4 (13, 14). The actual transition/transversion ratio was 3.1 for the data set used. Phylogenetic trees were constructed by UPGMA, Fitch-Margoliash, neighbor-joining, parsimony, and maximum-likelihood methods contained in the PHYLIP package. A bootstrap confidence analysis was performed with the Seqboot program of the PHYLIP package by using 100 data sets (14), and consensus trees were obtained by using the Consense program. Later, the topologies of the trees constructed by the neighbor-joining and Fitch-Margoliash methods were further tested by recalculating the pairwise evolutionary distances with Kimura's two-parameter model at a transition/transversion ratio of 3 or the Jukes-Cantor correction. The tree topologies and branch lengths were nearly identical to those shown below. Nucleotide sequence accession numbers. The GenBank accession numbers for the 16S rRNA sequences reported in this paper are as follows: "M. aeolicus," U39016; M. voltaei PST, U38461; M. voltaei A3, U38488; M. deltae RCT, U38485; M. maripaludis JJT, U38484; M. maripaludis C5, U38486; M. maripaludis C6, U38487; and M. maripaludis C7, U38941. These sequences are also available from the Ribosomal Database Project, University of Illinois. The GenBank accession numbers for the partial 23S rRNA sequences are as follows: "M. aeolicus," U39025, U39026, U39027, and U39028; M. voltaei PST, U39017, U39018, U39019, and U39020; and M. maripaludis JJT, U39021, U39022, U39023, and U39024.
U39016 U38461 U38488 U38485 U38484 U38486 U38487 U38941 U39025 U39026 U39027 U39028 U39017 U39018 U39019 U39020 U39021 U39022 U39023 U39024
pdf
Phylogenetic relationships and diversity within the Pasteurella haemolytica complex based on 16S rRNA sequence comparison and outer membrane protein and lipopolysaccharide analysis -- Davies et al. 46 (3): 736 -- International Journal of Systematic and Evolutionary Microbiology
for sequencing. The reaction products were loaded onto 8% polyacrylamide urea gels and electrophoresed, and bands were detected by exposure to X-ray film for 24 h. 16S rRNA data analysis. A program set for data entry, editing, sequence alignment, secondary-structure comparison, similarity matrix generation, and dendrogram construction for 16S rRNA data was written in Microsoft QuickBASIC for use with IBM PC-AT and compatible computers (28). The RNA sequences were entered and aligned as described previously (28). The sequence database contains approximately 100 16S rRNA sequences of members of the Pasteurellaceae. Similarity matrices were constructed from the aligned sequences by using only those sequence positions for which 90% of the strains had data. The similarity matrices were corrected for multiple base changes at single positions by the method of Jukes and Cantor (21). Phylogenetic trees were constructed by the neighbor-joining method of Saitou and Nei (30, 33). GenBank accession numbers. The GenBank accession numbers for the strains examined in this study are given in Table 2.
U57066 M75080 U57066 U57066 U57066 U57066 U57066 U57067 U57066 U57066 U57066 U57066 U57066 M75080 U57068 U57069 U57070 U57071 U57072 U57073 U57074 M75063 U57075 U57076 U57077 U57078 M75062 M75077 M75066 M75065
pdf
Treponema maltophilum sp. nov., a small oral spirochete isolated from human periodontal lesions -- Wyss et al. 46 (3): 745 -- International Journal of Systematic and Evolutionary Microbiology
GenBank, and DDBJ nucleotide sequence databases under accession number X87140.
X87140
pdf
Clostridium proteoclasticum sp. nov., a novel proteolytic bacterium from the bovine rumen -- Attwood et al. 46 (3): 753 -- International Journal of Systematic and Evolutionary Microbiology
Foster City, Calif.). M13 universal and reverse sequencing primers and the following internal primers for conserved regions of the 16S rRNA gene (5 to 3 ; E. coli numbering) were used to sequence both strands: primers F1 (positions 513 to 532; CGTGCCAGCAGCCGCGGTAA), F3 (positions 1094 to 1113; TCCCG CAACGAGCGCAACCC), R1 (positions 357 to 342; CTGCTGCCTCCCGT AG), and R6 (positions 1113 to 1094; GGGTTGCGCTCGTTGCGGGA). Closely related sequences obtained from the Ribosomal Database Project were used to construct a similarity matrix (12), and a phylogenetic tree was constructed (22) by using 1,100 unambiguous bases. Nucleotide sequence accession number. The 16S rDNA sequence of strain B316T has been deposited in the GenBank data library under accession number U37378.
U37378
pdf
Bacillus sporothermodurans, a new species producing highly heat- resistant endospores -- Pettersson et al. 46 (3): 759 -- International Journal of Systematic and Evolutionary Microbiology
in triplicate, and the results reported are mean values of reproducible patterns. Data were analyzed with GENSTAT software, and clustering was achieved by applying the unweighted pair-group method with arithmetic averages (4). Phenotypic characterization. Since the milk isolates grew poorly, if at all, on nutrient agar, standard tests for the characterization of Bacillus spp. (12, 29) were modified as described below. A loopful or a 40- l drop of a standard inoculum was used which comprised a 5-ml (0.9%) saline wash of cells from a BHI agar plate which had been incubated at 37 C for 2 days. Tests were performed as described previously (12, 29), but the basal medium was BHI agar rather than nutrient agar, and for casein hydrolysis, 1% skim milk was used as the substrate. Growth was determined after incubation at 10 C for 1 week in a water bath and after 2 days in an air incubator at 50 C. Utilization of citrate was detected in semisolid BHI agar as described by Gordon et al. (12) for fastidious organisms. The Voges-Proskauer test was conducted in MRVP broth (Oxoid), and reduction of nitrate was determined in BHI broth supplemented with 0.3% potassium nitrate. Urease activity was determined in Oxoid urea agar base in accordance with the manufacturer's instructions. Acid production from carbohydrates was determined over 14 days by using the standard ammonium salts sugar medium for Bacillus spp. (12). Strains were also examined for acid production from sugars by the method for fastidious strains described by Gordon et al. (12) but by replacing J broth with BHI broth. API 50CH trays were inoculated and incubated in accordance with the manufacturer's instructions. Nucleotide sequence accession numbers. One 16S rRNA sequence from each of the three different types of gene, as discussed below, is available from GenBank under accession number U49078 (type I), U49079 (type II), or U49080 (type III).
U49078 U49079 U49080
pdf
16S ribosomal DNA analysis of the genera Micromonospora, Actinoplanes, Catellatospora, Catenuloplanes, Couchioplanes, Dactylosporangium, and Pilimelia and emendation of the family Micromonosporaceae -- Koch et al. 46 (3): 765 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Strains investigated and culture conditions. Strains investigated in this study are listed in Table 1. All strains are deposited in the German Collection of Microorganisms and Cell Cultures GmbH. Except for two strains of the genus Pilimelia which were grown on medium 440, all strains were cultivated on medium 65 (Streptomyces medium) as indicated in the German Collection of Microorganisms and Cell Cultures catalog of strains (3). Analysis of 16S rDNA. Extraction of genomic DNA and amplification of the 16S rDNA were carried out as described previously (17). PCR products were sequenced directly with the Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems) according to the manufacturer's protocol. The sequence reactions were electrophoresed with the Applied Biosystems 373A DNA sequencer. Phylogenetic analysis. 16S rDNA sequences were compared with sequences in the existing 16S rDNA database of members of the order Actinomycetales. This database consists of sequences deposited in the Ribosomal Database Project (13). Similarity values were transformed into phylogenetic distance values that compensate for multiple substitutions at any given site in the sequence (8). The least-squares distance method of De Soete (2) as well as the programs Neighbor Joining (19) and Maximum Likelihood contained in the PHYLIP package (5) were used in the construction of phylogenetic dendrograms. For the calculation of bootstrap values, 200 trees were analyzed with the programs NJFIND and NJBOOT (kindly provided by T.S. Whittam, Department of Biology, Pennsylvania State University). Nucleotide sequence accession numbers. Sequences have been deposited at EMBL under the accession numbers shown in Table 1.
X93185 X93186 X93187 X93188 X93197 X93198 X93199 X93200 X93201 X93202 X93191 X93192 X93193 X93194 X93195 X43196 X93189 X93190
pdf
Isolation and identification of poly(3-hydroxyvalerate)-degrading strains of Pseudomonas lemoignei -- Mergaert et al. 46 (3): 769 -- International Journal of Systematic and Evolutionary Microbiology
Fatty acid analysis. Strains were grown on Trypticase soy broth (BBL) supplemented with 1.5% (wt/vol) Bacto Agar (Difco) and 0.1% (wt/vol) sodium-DL3-hydroxybutyrate (Serva) for 3 days at 28 C. Fatty acid methyl esters were prepared and separated by gas-liquid chromatography as described previously (1), with some modifications (26). The Microbial Identification System (Microbial ID, Inc., Newark, Del.) software package was used to identify the fatty acids. The same software package was used to cluster the fatty acid methyl ester profiles by the unweighted pair group method of averages (37) of Euclidean distances, which were calculated for each pair of profiles. Breathprinting with the Biolog system. Strains were grown on Delafield medium (7) supplemented with 0.3% (wt/vol) 3-hydroxybutyrate for 2 days at 28 C. Suspensions were prepared, and Biolog GN microplates (Biolog, Inc., Hayward, Calif.) were inoculated as recommended by the manufacturer. After 3 days of incubation at 28 C, the plates were read visually, and wells showing any color reaction, compared with the control well were interpreted as positive. Plasmid analysis. A plasmid analysis was performed by the method of Kado and Liu (16). Plasmid preparations were loaded onto an 0.8% (wt/vol) agarose gel and stained with ethidium bromide after electrophoresis. SDS-PAGE of whole-cell proteins. The bacterial cells in 2-ml stationary cultures grown with sodium valerate were harvested by centrifugation, resuspended in 0.2 ml of denaturation buffer, and boiled for 5 min. For SDS-PAGE, the method of Laemmli (19) was used. A 15- l portion of each extract was loaded onto an SDS12% (wt/vol) polyacrylamide gel. After electrophoresis, the proteins were stained with Coomassie blue and compared visually. 16S rDNA gene sequencing. The strains were incubated for 7 days in 5-ml portions of Trypticase soy broth (1.7% [wt/vol] Bacto Tryptone [Difco], 0.3%, [wt/vol] Bacto Soytone [Difco], 0.25% [wt/vol] Bacto Dextrose [Difco], 0.5% [wt/vol] NaCl, 0.25% [wt/vol] K2HPO4) supplemented with 0.1% (wt/vol) DL-3hydroxybutyrate under aerobic conditions. The genomic DNA of each strain was extracted by the method of Wilson (43). The 16S rDNA was amplified by PCR as described by Karlson et al. (17). The PCR products were sequenced directly by using a Taq Dye Deoxy terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.), and electrophoresis was performed with a model 373A automatic sequencer (Applied Biosystems). The 16S rDNA sequences were aligned by using the sequence editing and analyzing program of Olsen (31) and reference sequences from members of the Proteobacteria obtained from the Ribosomal RNA Database Project (20). Conserved regions were used for the initial alignment. Alignment of variable regions was aided by the results of an analysis of the secondary structure. Overall similarity values, incorporating the Jukes and Cantor (15) correction factor, were calculated for sequence pair comparisons. DNA base composition and DNA-DNA hybridizations. To prepare DNA, cells were grown at 28 C for 4 days in Roux flasks on minimal medium (7) supplemented with 0.3% (wt/vol) DL-3-hydroxybutyrate. DNA was prepared by the method of Marmur (22). The mean guanine-plus-cytosine (G C) contents of DNAs were determined by the thermal denaturation method (8, 23). Levels of DNA-DNA binding, expressed as percentages, were determined spectrophotometrically by the initial renaturation rate method of De Ley et al. (9). Each value was the average of the values from two hybridization experiments. The total DNA concentration used was 59 g/ml, and the optimal renaturation temperature, calculated from the G C content with the equation of De Ley (8), was 77.3 C in 2 standard saline citrate buffer (SSC) (1 SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7). Electron microscopy. Cells grown on minimal medium (35) supplemented with 0.3% (wt/vol) DL-3-hydroxybutyrate were negatively stained with 3% phosphotungstate and examined with a Phillips model EM 301 electron microscope operated at 80 kV. Nucleotide sequence accession numbers. The 16S rDNA gene sequences of P. lemoignei LMG 2207T and strain A62 have been deposited in the EMBL data library under accession numbers X92555 and X92554, respectively.
X92555 X92554
pdf
Taxonomic study of lancefield streptococcal groups C, G, and L (Streptococcus dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov [published erratum appears in Int J Syst Bacteriol 1997 Apr;47(2):605] -- Vandamme et al. 46 (3): 774 -- International Journal of Systematic and Evolutionary Microbiology
P11264 P13997
pdf
Polyphasic analysis of strains of the genus Capnocytophaga and Centers for Disease Control group DF-3 -- Vandamme et al. 46 (3): 782 -- International Journal of Systematic and Evolutionary Microbiology
a Numbers above the diagonal are uncorrected percentages of similarity, and those below the diagonal are percentages of difference corrected for multiple base changes by the method described by Jukes and Cantor. b 16S rRNA sequences for these strains are available for electronic retrieval from GenBank and EMBL under the indicated accession numbers.
D14307 D11344 U41350 U41353 U41354 U41351 L14635 L14636 U41349 L14638 L14637 U41352 U41348 U41347 U41346 L14639 M28236 M28238 U41355 D11344 D11344
pdf
Staphylococcus saprophyticus subsp. bovis subsp. nov., isolated from bovine nostrils -- Hajek et al. 46 (3): 792 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Spiroplasma syrphidicola sp. nov., from a syrphid fly (Diptera: Syrphidae) -- Whitcomb et al. 46 (3): 797 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Emended description of Herbaspirillum; inclusion of [Pseudomonas] rubrisubalbicans, a milk plant pathogen, as Herbaspirillum rubrisubalbicans comb. nov.; and classification of a group of clinical isolates (EF group 1) as Herbaspirillum species 3 -- Baldani et al. 46 (3): 802 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Sanguibacter inulinus sp. nov -- Pascual et al. 46 (3): 811 -- International Journal of Systematic and Evolutionary Microbiology
a The accession numbers of the 16S rRNA sequences of reference cellulomonads and oerskoviae are as follows: O. turbata, X79454; O. xanthineolytica, X79453; C. biazotea, X79462; C. cartae, X79456; C. cellasea, X79459; C. cellulans, X79455; C. flavigena, X79463; C. fermentans, X79458; C. fimi, X79460; C. gelida, X79461; and C. uda, X79457.
X79454 X79453 X79462 X79456 X79459 X79455 X79463 X79458 X79460 X79461 X79457
pdf
Analysis of 16S rRNA gene sequences of Vibrio costicola strains: description of Salinivibrio costicola gen. nov., comb. nov -- Mellado et al. 46 (3): 817 -- International Journal of Systematic and Evolutionary Microbiology
Voges-Proskauer and arginine decarboxylase tests are positive. Indole, -galactosidase, lysine decarboxylase, and ornithine decarboxylase tests are negative. The DNA base composition ranges from 49.4 to 50.5 mol% G C (as determined by the thermal denaturation method). Isolated from hypersaline environments (salterns, saline soils) and from salted food (cured meats and brines). The type species is Salinivibrio costicola (formerly Vibrio costicola). The genus Salinivibrio is a member of the gamma subclass of the Proteobacteria. The description of Salinivibrio costicola comb. nov. is based on the data of Garci et al. (7). The type strain of this species ´a is strain NCIMB 701 ( ATCC 33508); its G C content is 50.0 mol% (as determined by the CsCl method or 49.9 mol% (as determined by the thermal denaturation method). Nucleotide sequence accession numbers. The nearly complete primary sequences of the 16S rRNA genes of V. costicola strains which we determined have been deposited in the EMBL data library under the following accession numbers: V. costicola NCIMB 701T, X95527; V. costicola AV3, X95528; V. costicola 6, X95531; V. costicola E-367, X95529; V. costicola V-15, X95530; and V. costicola H-178, X95532.
X95527 X95528 X95531 X95529 X95530 X95532
pdf
Polaromonas vacuolata gen. nov., sp. nov., a psychrophilic, marine, gas vacuolate bacterium from Antarctica -- Irgens et al. 46 (3): 822 -- International Journal of Systematic and Evolutionary Microbiology
Department of Microbiology (357242), University of Washington, Seattle, Washington 98195 Several strains of a novel heterotrophic gas vacuolate bacterium were isolated from antarctic marine waters. The results of phylogenetic analyses in which 16S ribosomal DNA sequencing was used, coupled with phenotypic tests, indicated that strain 34-PT (T type strain) belongs to a new genus and species of the beta subgroup of the Proteobacteria, for which the name Polaromonas vacuolata is proposed. Although the other four strains studied probably belong to this new species, DNA-DNA hybridization tests were not conducted. The closest phylogenetic relatives of P. vacuolata are the photosynthetic nonsulfur purple bacterium Rhodoferax fermentans and the hydrogen autotroph Variovorax paradoxus. Although gas vacuolate heterotrophic bacteria are wellknown inhabitants of aquatic ecosystems, until recently none of these organisms had been observed in or isolated from marine habitats. In 1989 several types of gas vacuolate bacteria were found in Antarctica growing in association with the sea ice microbial community (9, 13). Sequencing and analyses of 16S ribosomal DNAs (rDNAs) of a variety of these Antarctic gas vacuolate bacteria revealed that they were members of the Proteobacteria and the Flavobacterium-Cytophaga-Bacteroides phylogenetic groups (6). Within the Proteobacteria, the alpha, beta, and gamma subgroups were represented. In this paper gas vacuolate members of the beta subgroup of the Proteobacteria that were isolated from the Palmer Peninsula area in Antarctica are described. Evidence that indicates that this group of strains comprises a new bacterial genus and species, Polaromonas vacuolata, is presented. All strains were isolated from Antarctic waters off the Palmer Peninsula near the U.S. Palmer Station, Anvers Island, Antarctica. Several strains, including 34-PT (T type strain), 41-P, 54-P, J-A, and J-B, were isolated from samples collected beneath sea ice (9). The presence of gas vesicles was confirmed by phase-contrast microscopy (Fig. 1) and by transmission electron microscopy (Fig. 2). The strains were grown and characterized as described previously (9), with the addition of tests for assessing generation time and urease activity (5). Resistance to various antibiotics was tested by placing a paper disk containing an antibiotic onto an SWC-m agar plate onto which the test strain had been spread. The plates were incubated at 4 C, and susceptibility was determined by the presence of a zone of clearing that was more than 40 mm wide. The fatty acid compositions of all of the strains and the 16S rDNA nucleotide sequence of strain 34-PT were also determined as described previously (6). Our 16S rDNA sequence was compared with the sequence determined independently in the laboratory of C. R. Woese (17). The 16S rDNA sequence of 34-PT was aligned with the most similar sequences in Ribosomal Database Project (RDP) release 5.0 by using the ALIGN_SEQUENCE program (10) and by manually comparing the structure with secondary structures provided by the RDP (7). Prealigned 16S rRNA sequences for the following organisms were also obtained from the RDP (GenBank accession numbers are given in parentheses): Thiobacillus perometabolis ATCC 23370 (M79421 to M79423), Sphaerotilus natans (Z18534), Rubrivivax gelatinosus ATCC 17011T (D16213), Brachymonas denitrificans JCM 9216T (D14320), Comamonas testosteroni ATCC 11996T (M11224), Stripa-derived bacterium (L20811), Variovorax paradoxus IAM 12373T (D30793), str. PAD44 (D26231), Rhodoferax fermentans JCM 7819T (D16211), Alcaligenes faecalis ATCC 8750T (M22508), and Bordetella parapertussis ATCC 15311T (U04949). Finally, a BLAST search was also performed with the 1 October 1995 release of GenBank to determine if there were any sequences that were closely related to the sequence of 34-PT but were not included in RDP release 5.0. Phylogenetic trees were generated by using PAUP, version 3.0s (14), for parsimony analysis, DNADIST and NEIGHBOR (4) for distance analysis, and fastDNAml (3, 12) for likelihood analysis. MacClade, version 3.05 (11), was used to determine transition and transversion frequencies. The results of phenotypic tests for growth, carbon source utilization, and various physiological features, as well as G C contents, have been reported previously (9); in addition, the following characteristics were also determined. The bacteria which were studied were short, unicellular, gram-negative rods (0.8 by 2 to 3 m) that typically produced gas vacuoles which appeared as bright refractile areas within the cells (Fig. 1). Although the cells were nonmotile under usual culture conditions, they produced polar flagella in addition to gas vacuoles (Fig. 2). These bacteria produced circular, convex colonies with smooth, glistening surfaces and entire edges on agar plates. The colonies were chalky white in pigmentation. No growth occurred on SWC plates containing glucose (0.1%) or L-arginine (0.1%) as a carbon source when the plates were incubated in anaerobic jars (GasPak; BBL, Baltimore, Md.). The generation time, calculated from A600 values at 4 C, was 40 h. Strain 34-PT grew well at 0 to 12 C. It did not grow at 15 C. This strain grew when the initial pH of the medium was 6.0 to 9.5. The pH of the spent medium was approximately 7.0 in all cases, except when sugars were present, in which case the pH was between 6.0 and 7.0. Good growth occurred in the presence of 0 to 6.0% NaCl. No growth occurred in the presence of 7.0% NaCl. P. vacuolata 34-PT was positive for urease and deaminase activities; susceptible to novobiocin (30 g), tetracycline (30 g), and neomycin (30 g); and resistant to streptomycin (10 g) and gentamicin (10 g). Strain 34-PT grew when the tryptone, yeast extract, beef extract, and vitamins of SWC-m were replaced with vitaminfree Casamino Acids (Difco Laboratories, Detroit, Mich.), indicating that vitamins are not required for growth. Good
M79421 M79423 Z18534 D16213 D14320 M11224 L20811 D30793 D26231 D16211 M22508 U04949
pdf
Phylogenetic analysis of genes coding for 16S rRNA in mammalian ureaplasmas -- Harasawa and Cassell 46 (3): 827 -- International Journal of Systematic and Evolutionary Microbiology
(7), using the DNASIS software package (Hitachi Software Engineering Co., Yokohama, Japan). A phylogenetic tree was constructed by the neighbor-joining method (17). The nucleotide sequences of the 16S rDNAs of strains T960T and 27 of the two biovars of U. urealyticum (19) were obtained from nucleotide sequence databases. The nucleotide sequence of U. gallorale was not included in this study since the U. gallorale 16S rRNA gene was not amplified by the PCR primers used, which suggests that the avian ureaplasmas may be genetically different from the mammalian ureaplasmas. The 16S rDNAs of six strains of the mammalian Ureaplasma species were aligned for maximum matching (Fig. 1). The alignment of the six Ureaplasma strains showed that there were conserved and variable regions in the 16S rDNAs. Nucleotide substitutions were not limited to a particular region of the predicted secondary structures (data not shown). In the present study, we constructed a phylogenetic tree for the mammalian Ureaplasma species based on the nucleotide sequences of the 16S rRNA genes (Fig. 2); this tree corresponds to the proposed evolutionary tree of the host animal species (11). However, the phylogenetic tree showed closer relationships (97.3% homology between the strains belonging to the two human Ureaplasma biovars, strains T960T and 27, and 96.8% homology between the two feline Ureaplasma species, U. felinum and U. cati). Although determinants for host ranges and susceptibilities to mycoplasma infections are currently unknown, Ureaplasma species, as well as Mycoplasma species, have defined host ranges consisting of specific animal species. Our data suggest that the origin of the mammalian Ureaplasma species dates back to about 100 106 years ago because the Mammalia, including human, bovine, canine, and feline lines, are thought to have diverged almost simultaneously during the Cretaceous period. Thus, the Ureaplasma species seem to have coevolved with their host animal species after this divergence, and rigid host-parasite relationships were established during the evolutionary process. Nucleotide sequence accession numbers. The nucleotide sequences determined in this study have been deposited in the DDBJ, EMBL, GSDB, and NCBI nucleotide sequence databases under accession numbers D78648 (U. canigenitalium), D78649 (U. cati), D78650 (U. diversum), and D87651 (U. felinum).
D78648 D78649 D78650 D87651
pdf
Taxonomic note: a proposal for reviewing the interpretation of the CAMP reaction between Listeria monocytogenes and Rhodococcus equi -- Fernandez-Garayzabal et al. 46 (3): 832 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Novel Psychrobacter species from Antarctic ornithogenic soils -- Cavanagh et al. 46 (4): 841 -- International Journal of Systematic and Evolutionary Microbiology
Nichols (30). DNA was extracted from strains by the Marmur procedure, and the G C content was determined by the thermal denaturation method (25). DNADNA hybridization was performed by using the procedure of Huss et al. (7) and DNA sheared by sonication in 2 SSC (0.03 M sodium citrate plus 0.3 M NaCl, pH 7.0). Phylogenetic analyses. The 16S rDNA genes of various Psychrobacter strains and M. phenylpyruvica ACAM 535T were amplified by PCR by using primers 27f and 1525r (12). Each PCR mixture contained each deoxynucleotide at a concentration of 50 M, 2.5 mM magnesium chloride, PCR buffer IV (25 mM ammonium sulfate, 75 mM Tris-HCl [pH 9.0], 0.01% Tween 20), 50 pmol of each primer, 5% (vol/vol) dimethyl sulfoxide, 50 to 100 ng of genomic DNA, and 1 U of thermostable DNA polymerase (Advanced Biotechnologies, Surrey, United Kingdom). The PCR were performed in a Corbett Research model FTS-960 thermocycler. The reaction parameters included an initial 5-min incubation at 94 C, followed by 30 cycles consisting of 94 C for 1 min, 50 C for 1 min, and 72 C for 5 min. PCR products were purified with a Qiaex II gel extraction kit (Qaigen, Inc., Chatsworth, Calif.). The 16S rDNA genes were cloned by using the pGEM vector cloning system (Promega Corp., Madison, Wis.), and plasmids were purified with a Wizard Miniprep kit (Promega). Sequences of the 16S rDNA insertion were then generated with an Applied Biosystems model 3738A automated sequencer by using a fluorescent-dye terminator cycle sequencing kit and previously described 16S rDNA primers (12). The 16S rDNA sequences were aligned with other sequences downloaded from the Ribosomal Database Project by using the Australian National Genomic Information Service. PHYLIP (version 3.5) (6) was then utilized for phylogenetic analyses, and evolutionary distances were determined with the maximum-likelihood algorithm by using the DNADIST program. Unrooted phylogenetic trees were obtained by using the FITCH program and a bootstrap analysis (1,000 replicates) was performed by using the programs SEQBOOT and CONSENSE. Nucleotide sequence accession numbers. The GenBank accession numbers for the 16S rDNA sequences generated in this study are as follows: P. immobilis ACAM 521T U39399; P. immobilis ACAM 282, U46140; P. immobilis ACAM 286, U46139; P. uratovorans ACAM 534T, U46141; P. uratovorans ACAM 300, U46142; P. frigidicola ACAM 304T, U46143; and M. phenylpyruvicus ACAM 535T, U46144. The GenBank accession numbers for the 16S rDNA sequences utilized for comparison in this study are as follows: Acinetobacter calcoaceticus, M34139; Moraxella catarrhalis, U10876; Moraxella cuniculi, X79221; Moraxella lacunata, X74895; Moraxella osloensis, X74897; and Moraxella ovis, X74896.
U39399 U46140 U46139 U46141 U46142 U46143 U46144 M34139 U10876 X79221 X74895 X74897 X74896
pdf
Bordetella trematum sp. nov., isolated from wounds and ear infections in humans, and reassessment of Alcaligenes denitrificans Ruger and Tan 1983 -- Vandamme et al. 46 (4): 849 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Phylogenesis of relapsing fever Borrelia spp -- Ras et al. 46 (4): 859 -- International Journal of Systematic and Evolutionary Microbiology
TABLE 1. Sources and nucleotide sequence accession numbers of RF Borrelia strains used in this study
U42292 U42296 U42299 U42284 U42286 U42300 U42297 U42294 U42283 U42285 U42287 U42289 U42295 U42290 U42291 U42301 U42302 U42288 U42298 U42293 D45192 U23211 X57404
pdf
Emendation of the genus Planococcus and transfer of Flavobacterium okeanokoites Zobell and Upham 1944 to the genus Planococcus as Planococcus okeanokoites comb. nov -- Nakagawa et al. 46 (4): 866 -- International Journal of Systematic and Evolutionary Microbiology
and a Wakopak WS-PTC column (Wako Pure Chemical Industries) as recommended by the column manufacturer. DNA base composition analysis. DNA was extracted by the methods of Marmur (17) and Saito and Miura (23) with the modifications described previously (20). The guanine-plus-cytosine (G C) content of the DNA was determined by the method of Mesbah et al. (18). DNA-DNA hybridization. Levels of DNA relatedness were determined by the photobiotin-microplate method of Ezaki et al. (7). PCR amplification, cloning, and sequencing of 16S ribosomal DNA. The 16S rRNA gene was amplified by PCR (22) by using TaKaRa Taq (Takara Shuzo, Kyoto, Japan) and primers 9F and 1541R (20). The 1.5-kb amplified 16S ribosomal DNA fragment was purified by agarose gel electrophoresis and with a Prep-A-Gene DNA purification kit (Bio-Rad Laboratories, Hercules, Calif.). The methods used for cloning and sequencing of the purified fragment have been described previously in detail (20). The 5 -fluorescein-labeled oligonucleotide primers used were M13 Universal and Reverse Primer (Pharmacia), as well as primers 339F (5 -CTCCTACGGGAGGCAGCAG; same sequence as positions 339 to 357 [Escherichia coli numbering system]), 785F (5 -GGATTAGATACC CTGGTAGTC; same sequence as positions 785 to 805), 1099F (5 -GCAACG AGCGCAACCC; same sequence as positions 1099 to 1115), 536R (5 -GTATT ACCGCGGCTGCTG; complementary to positions 519 to 536), 802R (5 -TAC CAGGGTATCTAATCC; complementary to positions 785 to 802), and 1115R (5 -AGGGTTGCGCTCGTTG; complementary to positions 1100 to 1115). Phylogenetic analysis. The 16S rRNA sequences of the strains examined and the sequences of reference organisms obtained from databases were aligned with the E. coli sequence (4) (for the accession numbers of the strains see Table 4). The CLUSTAL V software package (11) was used to generate evolutionary distances (Knuc values [14]) and similarity values and to construct a phylogenetic tree by using the neighbor-joining method (24) and the Knuc values. The positions at which secondary structures varied between strains (positions 66 to 103, 179 to 220, 447 to 487, 841 to 845, 1004 to 1036, 1134 to 1140, and 1256 to 1281) and the positions at which sequences were not determined in some reference organisms (positions 1431 to 1491) were excluded from the analysis. The total number of nucleotides compared was 1,136 after we eliminated all sites at which sequences were not determined in any organisms. The topology of the phylogenetic tree was evaluated by the bootstrap resampling method of Felsenstein (8) with 1,000 replicates. Nucleotide sequence accession number. The 16S ribosomal DNA sequence of F. okeanokoites IFO 12536T has been deposited in the DDBJ, EMBL, GSDB, and NCBI nucleotide sequence databases under accession number D55729.
D55729
pdf
Anaerofilum pentosovorans gen. nov., sp. nov., and Anaerofilum agile sp. nov., two new, strictly anaerobic, mesophilic, acidogenic bacteria from anaerobic bioreactors -- Zellner et al. 46 (4): 871 -- International Journal of Systematic and Evolutionary Microbiology
distance values that compensated for multiple substitutions at any given site in the sequence (15). The least-squares distance method of De Soete (6) and the neighbor-joining and maximum-likelihood programs in the PHYLIP package (8) were used to construct phylogenetic dendrograms (23). To calculate bootstrap values, 300 trees were analyzed by using the NJFIND and NJBOOT programs. Nucleotide sequence accession numbers. The sequences of the 16S rDNAs of strains FaeT and FT have been deposited in the EMBL database under accession numbers X97852 and X98011, respectively.
X97852 X98011
pdf
Gordona hirsuta sp. nov -- Klatte et al. 46 (4): 876 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Bacterial strains and cultivation. Strain K718aT and the reference strains used in this study are deposited in the DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany. Strain K718aT was isolated from wet-ground filter material (fiber bark compost) from a large-scale biofilter on antibiotic sulfonamide sensitivity test agar (Merck, Darmstadt, Germany) by using an agar plate culture technique. For analyses of cellular fatty acids and mycolic acids all strains were grown on TSB agar (3% [wt/vol] Trypticase soy broth [BBL], 1.5% [wt/vol] Bacto Agar [Difco]) for 4 days at 28 C. Physiological properties were determined after growth on GYM agar (0.4% [wt/vol] D-glucose, 0.4% [wt/vol] yeast extract, 1% [wt/vol] malt extract, 1.2% [wt/vol] agar no. 1 [Oxoid]) for 3 days at 28 C. The bacterial biomass used to determine the G C content of the DNA and for the cell wall analysis was obtained from shake cultures grown in Trypticase soy broth (BBL) for 4 days at 28 C. Physiological property tests. Carbon source utilization and qualitative enzyme tests were performed in standard microtitration plates (F-form; Greiner, Nurtin¨ gen, Germany) as described previously (10). Briefly, the test panels were inoculated with a standardized bacterial suspension and incubated for 24 h at 28 C. After an indicator solution containing the redox dye tetrazolium-[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) was added to the auxonographic test and control wells (9), the preparations were incubated for an additional 24 h in the dark. The auxonographic test results were determined photometrically. The results of the enzyme tests were evaluated visually; any visible color indicated that cleavage of the chromogenic substrate had occurred. Cell wall analysis. Isoprenoid quinones, polar lipids, cell wall diamino acids, and sugars were examined by using previously described methods (12). The acyl type of the peptidoglycan was identified by the method of Uchida and Aida (28), modified by passing the hydrolysate through a cation exchanger (Bond Elut SCX; Varian). Fatty acid methyl esters were prepared from wet cells (40 to 70 mg) as described previously (17) and were identified by gas chromatography with a model 5898A Microbial Identification System apparatus (Microbial ID, Newark, Del.). Mycolic acids were examined as trimethylsilylated derivatives by hightemperature gas chromatography with a modified model 5898A Microbial Identification System apparatus equipped with a 12-m HT5 column (part 051385; SGE, Victoria, Australia) as described previously (10). Analysis of DNA base composition. DNA was isolated by using a modification of the Marmur method (15) and was purified by treatment with proteinase K. DNA was degraded to nucleosides by using P1 nuclease and bovine intestinal mucosa alkaline phosphatase as described by Mesbah et al. (16). Nucleosides were separated by reversed-phase high-performance liquid chromatography (HPLC) as described by Tamaoka and Komagata (24). The G C content was calculated from the ratios of deoxyguanosine and thymidine. The HPLC system used consisted of a model LC-9A solvent delivery module, a model DGU-3a online degasser, a model CTO-10AC column oven, a model SIL-9A automatic sample injector, and a model SPD-6A UV spectrophotometer-detector connected to a model C-R4AX Chromatopac integrator (Shimadzu Corp., Tokyo, Japan). 16S rDNA sequencing. Extraction of genomic DNA and amplification of the 16S ribosomal DNA (rDNA) were carried out as described previously (19). PCR products were sequenced directly by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.) as recommended by the manufacturer. The sequence reaction mixtures were electrophoresed by using an Applied Biosystems model 373A DNA sequencer. The 16S rDNA sequences were aligned manually with the sequences currently available from the public databases. Evolutionary distances were calculated as described by Jukes and Cantor (8). The algorithm of De Soete (3) was used to construct a phylogenetic dendrogram from the distance matrices. The stability of the phylogenetic tree was determined by using the SEQBOOT program (4). A total of 1,000 bootstrapped trees were generated. Nucleotide sequence accession number. The 16S rDNA sequence of strain K718aT has been deposited in the EMBL database under accession number X93485.
X93485
pdf
Reduction of benzyl viologen distinguishes genera of the class Mollicutes -- Pollack et al. 46 (4): 881 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Comparative metabolism of Mesoplasma, Entomoplasma, Mycoplasma, and Acholeplasma -- Pollack et al. 46 (4): 885 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species -- Birtles and Raoult 46 (4): 891 -- International Journal of Systematic and Evolutionary Microbiology
Nucleotide sequence accession numbers. The 16S rRNA gene sequences which we determined have been deposited in the EMBL data bank under the following accession numbers: strain C1-phy, Z70006; strain C4-phy, Z70007; strain C5-rat, Z70008; strain C7-rat, Z70004; strain R-phy1, Z70005; strain Rphy2, Z70001; strain N40, Z70002; and B. bacilliformis LA6.3, Z70003. The 16S rRNA gene sequence accession numbers for the eight currently recognized Bartonella species are shown in Table 1, and the 16S rRNA gene sequence accession numbers for the organisms used for comparison are as follows: Rickettsia prowakezii, M21789; Acinetobacter anitratum, U10874; Corynebacterium glutamicum, X80629; Rhizobium tropici, U38469; Escherichia coli, Z46753; and Coxiella burnetii, M21291. The gltA sequences which we determined have been deposited in the EMBL data bank under the following accession numbers: B. bacilliformis LA6.3, Z70021; Bartonella doshiae, Z70017; Bartonella elizabethae, Z70009; Bartonella type strain), Z70014; Bargrahamii, Z70016; Bartonella quintana FullerT (T tonella taylorii, Z70013; Bartonella vinsonii, Z70015; strain C1-phy, Z70022; strain C4-phy, Z70019; strain C5-rat, Z70018; strain C7-rat, Z70020; strain R-phy1, Z70010; strain R-phy2, Z70011; and strain N40, Z70012. The gltA sequence accession numbers for the reference organisms are as follows: Rhizobium prowazekii, M17149; A. anitratum, M33037; Corynebacterium glutamicum, X71489; Rhizobium tropici, Z34516; E. coli, J01619; and Coxiella burnetii, L33409.
Z70006 Z70007 Z70008 Z70004 Z70005 Z70001 Z70002 Z70003 M21789 U10874 X80629 U38469 Z46753 M21291 Z70021 Z70017 Z70009 Z70014 Z70016 Z70013 Z70015 Z70022 Z70019 Z70018 Z70020 Z70010 Z70011 Z70012 M17149 M33037 X71489 Z34516 J01619 L33409
pdf
Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae -- Fukunaga et al. 46 (4): 898 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Borrelial strains. All of the borrelial strains examined in this study are listed in Table 1. Most of these strains are associated with Lyme disease or relapsing fever. The rest are animal spirochetosis strains or strains whose pathogenicity is unknown. Borreliae were grown in 50 ml of BSKII medium (5) at 31 C for 1 to 3 weeks and were harvested by centrifugation as described previously (27). Cells of Borrelia duttonii 406K were kindly provided by H. Konishi and T. Nakazawa, Yamaguchi University School of Medicine, Ube, Japan. Extraction and purification of borrelial DNAs were carried out as described previously (24). RFLP ribotyping. Borrelial DNAs were digested with EcoRV or HincII, electrophoresed in 0.7% agarose gels, and blotted onto membranes by the method of Southern (59). 23S rRNA gene fragments NP and Sty from B. burgdorferi sensu stricto strain B31 were labeled and used as hybridization probes as described previously (25). The other experimental conditions used in the RFLP analysis have been described in detail previously (46, 47). Ribotypes I, II, and III corresponded to B. burgdorferi sensu stricto, B. garinii, and B. afzelii, respectively. Although ribotypes IV, V, and VI were previously considered unknown species, our recent studies revealed that these taxa are intraspecies variants of B. garinii (23). In addition, four new ribotypes, ribotypes VII (group Hk501), VIII (group Ya501), IX (Borrelia sp. strain Am501), and X (B. japonica), were created for unique borreliae found in Japan (21, 46). Flagellin gene sequencing. The flagellin gene was amplified by PCR, purified, ligated into vector pGEM5Zf by using the pGEM-T vector system (Promega Biotech, Madison, Wis.), and introduced into competent cells of Escherichia coli JM109 or HB101 (Takara Shuzo Co., Ltd., Kyoto, Japan) by the method described previously (22, 23). Single-stranded recombinant DNA was extracted and was purified as described previously (20). Occasionally, double-stranded plasmid DNA was extracted and used for experiments. Nucleotide sequences were determined by using an Autoread sequencing kit and an ALFred sequencer (Pharmacia, Uppsala, Sweden). The sequencing reaction mixtures were primed with either vector-encoded primers or custom-synthesized primers as described previously (22, 23). At least two clones were sequenced for each PCR product. Sequences were aligned and a similarity matrix and neighbor-joining phylogenetic tree were constructed with a Macintosh personal computer by using the DNASTAR program (DNASTAR, Inc., Madison, Wis.) and the CLUSTAL V software package (29, 57). PCR-RFLP analysis. PCR amplification was carried out to synthesize the partial flagellin gene sequences of borrelial strains. The following oligonucleotide primer set was used: 5 -GCA GTT CAA TCA GGT AAC GG-3 (sense primer C) and 5 -AGG TTT TCA ATA GCA TAC TC-3 (antisense primer D). Primers C and D are located at nucleotide positions 280 to 299 and 844 to 863, respectively, of the previously published sequence for the flagellin gene of B. garinii HT22 (23). We verified that both primers were Borrelia specific by using the BLAST (basic local alignment search tool) algorithm and the GenBank database. To prepare template DNA, 1 ml of a spirochete culture in BSK II medium was centrifuged, and the resulting cell pellet was rinsed twice with phosphate-buffered saline. The cells were suspended in 50 l of 0.1% Triton X-100 and were incubated at 95 C for 10 min. The target DNA sequence was amplified in a 50- l (total volume) reaction mixture containing 5 l of cell supernatant, each deoxynucleotide triphosphate at a concentration of 200 M, of the primers at a concentration of 1 M, 1.5 U of Taq polymerase (Ex Taq; Takara), and Ex Taq reaction buffer. The reaction mixtures were overlaid with mineral oil and were subjected to 30 thermal cycles consisting of 94 C for 40 s, 50 C for 40 s and 72 C for 40 s. The amplified DNA was digested with HapII, HhaI, HincII (Takara), CelII (Pharmacia), or DdeI (TOYOBO, Osaka, Japan). The amplified products and endonuclease digests were electrophoresed in a 2.5% agarose gel (NuSieve GTG; FMC, Rockland, Maine), and the DNA bands were visualized by ethidium bromide staining. DNA ladders (100-bp ladder [100 to 1,000 bp] and 20-bp ladder [20 to 1,000 bp]; GenSura Laboratories, Del Mar, Calif.) were used as size markers. Nucleotide sequence accession numbers. The flagellin gene sequences of Bor-
D82846 D82847 D82848 D85069 D85070 D82849 D82850 D82851 D85071 D82852 D82853 D82854 D82855 D82856 D82857 D82858 D83762 D83763 D83764 D82859 D82860 D82861 D82862 D82863 D82864 D63373 D63365 D63366 D43777 X16933 X75200 X56334 X75203 X75202 U28499 U28498 X75204 U28496 U26704 M33839 X75201 X16933 X75200 X56334 D82846 D63363 D63367 D63368 D63373 D63374 D63371 D63372 X75203 D63364 D63370 D63369 D63366 D63365 X75202 D82847 D85069 D85070 D82848 D82849 D82850 D82851 D85071 D82854 D82855 D82852 D82853 D82856 D82857 D82858 D83762 D83763 D83764 U28499 U28498 D82859 X75204 U28496 D43777 D82860 U26704 M33839 D82861 D82862 D82863 X75201 D82864
pdf
Helicobacter trogontum sp. nov., isolated from the rat intestine -- Mendes et al. 46 (4): 916 -- International Journal of Systematic and Evolutionary Microbiology
GenBank or the Ribosomal Database Project. The reference strains used in the 16S rRNA analysis are shown in Table 2. Similarity matrices were constructed from the aligned sequences by using only sequence positions for which 90% of the strains had data. The similarity matrices were corrected for multiple base changes by the method of Jukes and Cantor (13). Phylogenetic trees were constructed by using the neighbor-joining method of Saitou and Nei (25, 30). Identification of strains by PCR with specific primers. After the complete sequences of the first three isolates of H. trogontum were determined, PCR primers B72 and B39 (Table 1) were designed for rapid identification of additional isolates. The expected PCR product when these primers are used is 888 bases long (because H. trogontum 16S rRNA is shorter than Escherichia coli 16S rRNA, the amplicon length cannot be determined from the difference between the start of the forward primer and the end of the reverse primer [the primers are numbered relative to the E. coli sequence]). The additional three strains tested were cultured on Trypticase soy blood agar plates. A loopful of cells was harvested and suspended in a PCR tube with 15 l of GeneReleaser (Bioventures, Inc.). The GeneReleaser microwave protocol was used. PCR amplification was performed as described above for 16S rRNA, except that the annealing temperature was 63 C. The amplification products were electrophoresed on a 1% agarose gel and were visualized by ethidium bromide staining. Nucleotide sequence accession numbers. The GenBank nucleotide sequence accession numbers and culture collection numbers for the strains examined in this study are shown in Table 2.
U65103 M88137 L10079 L10080 M88148 U18766 L13464 M88150 M57398 M88154 U07574 M35048 M80205 X67854 M88147 L36141 M88157 M88139 M88144 M88151 U65103
pdf
High degree of similarity between Chromatium vinosum and Chromatium minutissimum as revealed by riboprinting -- Mas-Castella et al. 46 (4): 922 -- International Journal of Systematic and Evolutionary Microbiology
Nineteen restriction enzymes, AluI, ApaI, AvaI, AvaII, BanI, BglII, DdeI, EcoRI, HaeIII, HhaI, HincII, HinfI, MboI, MspI, NciI, PstI, SalI, SmaI, and RsaI, generated identical patterns for C. minutissimum and the three strains of C. vinosum studied. The lengths of the fragments were the lengths expected from the previously reported sequence of C. vinosum (GenBank accession number M26629). A total of 7 of the 25 restriction enzymes, AluI, AvaII, BglII, DdeI, HhaI, MboI, and PstI, revealed differences between C. gracile and the four other strains studied (Fig. 1). Spacer region. The amplified spacer region was approximately 600 bp long in C. gracile and almost 700 bp long in the other Chromatium strains. In C. gracile, three additional fainter bands larger than the main band were observed. In the four other strains, a fainter band smaller than the main band was observed. Eleven restriction enzymes, AccI, ApaI, BamHI, BglII, EcoRI, HincII, KpnI, MboII, RsaI, SalI, and SmaI, did not cut any of the DNA preparations. Fourteen restriction enzymes, AluI, AvaI, AvaII, BanI, DdeI, HaeIII, HhaI, HindIII, HinfI, MboI, MspI, NciI, PstI, and SstI, generated identical patterns for C. minutissimum and the three strains of C. vinosum. A total of 13 of the 25 restriction enzymes, AluI, AvaI, AvaII, BanI, DdeI, HaeIII, HindIII, HinfI, MboI, MstI, NciI, PstI, and SstI, revealed differences between C. gracile and the four other strains (Fig. 2). The data obtained in this study are summarized in Table 1. DISCUSSION On the basis of the identical riboprints we concluded that C. minutissimum is very similar to C. vinosum. Since only one strain of C. minutissimum was used and only one method was used, no conclusion concerning the relationship of these organisms can be drawn from the results of our analyses. Riboprinting is a powerful technique for clarifying the real identities of microorganisms whose morphological differences are minimal. This technique revealed that the pathogenic and nonpathogenic forms of the intestinal parasite genus Entamoeba are in fact two different species (5). A free-living amoeba that on morphological grounds was described as a Willaertia sp. turned out to be a Naegleria sp. with an aberrant life cycle when riboprinting was used (7). In some bacterial groups in which strain isolation and cultivation are not easy, phenotypic information may not be sufficient for classification. This is the case with phototrophic bacteria. Genotypic information may help in these cases to provide greater insight into the taxonomy of the groups. Although different physiological and ecological aspects of the purple phototrophic bacteria have been described, little is known about the genetics of these organisms. Our knowledge of anoxyphotobacteria is confined to the family Rhodospirillaceae (15, 16). Riboprinting may be used as a fast and costeffective molecular technique to help clarify the taxonomy of special bacterial groups. As expected, the SSU rRNA gene of Chromatium spp. is more conserved than the intergenic spacer region (internally transcribed spacer [ITS]) between the 16S and 23S ribosomal genes. In this study 7 and 13 of 25 restriction enzymes revealed RFLP differences between C. vinosum and C. gracile in the SSU and ITS regions, respectively. Identical RFLP patterns for the SSU and ITS regions were obtained for the three C. vinosum strains and the C. minutissimum strain. The amplified ITS of these strains were also the same size. We concluded that C. minutissimum is very similar to C. vinosum.
M26629
pdf
A proposal to transfer Microbispora bispora (Lechevalier 1965) to a new genus, Thermobispora gen. nov., as Thermobispora bispora comb. nov -- Wang et al. 46 (4): 933 -- International Journal of Systematic and Evolutionary Microbiology
U48993; Streptosporangium nondiastaticum, U48994; Streptosporangium pseudovulgare, U48995; Streptosporangium roseum, U48996; Streptosporangium violaceochromogenes, U48997; Streptosporangium viridialbum, U48998; and Streptosporangium vulgare, U48999. The sequences of the following organisms were retrieved from public databases: Actinosynnema mirum (EMBL accession number X84447), Bifidobacterium bifidum (GenBank accession number U25952), Geodermatophilus obscurus (EMBL accession number L40620), Kibdelosporangium aridum (EMBL accession number M29283), Nocardia asteroides (EMBL accession number X57949), Nocardia seriolae (EMBL accession number X36925), Promicromonospora enterophila (EMBL accession number X83807), Saccharothrix coeruleofusca (EMBL accession number X76963), Saccharothrix mutabilis (EMBL accession number X76965), Saccharopolyspora erythraea (EMBL accession number X53198), Saccharopolyspora hirsuta (EMBL accession number X53196), Saccharomonospora caesia (EMBL accession number Z38024), Saccharomonospora viridis (EMBL accession number Z38007), Streptomyces coelicolor (EMBL accession number Y00411), Streptomyces galbus (EMBL accession number X79852), Tsukamurella inchonenesis (EMBL accession number X85955), and Tsukamurella paurometabola (EMBL accession number Z36933).
U48994 U48995 U48996 U48997 U48998 U48999 X84447 U25952 L40620 M29283 X57949 X36925 X83807 X76963 X76965 X53198 X53196 Z38024 Z38007 Y00411 X79852 X85955 Z36933
pdf
Proposal for two new genera, Brevibacillus gen. nov. and Aneurinibacillus gen. nov [published erratum appears in Int J Syst Bacteriol 1997 Jan;47(1):248] -- Shida et al. 46 (4): 939 -- International Journal of Systematic and Evolutionary Microbiology
pology (8) was performed by using the CLUSTAL W program (35). Alignment gaps and unidentified base positions were not taken into account in the calculations. Identification of strains belonging to the Bacillus brevis group and the Bacillus aneurinolyticus group by 16S rRNA gene amplification. Strains belonging to the Bacillus brevis group and the Bacillus aneurinolyticus group were identified by 16S rRNA gene amplification by using specific detection primers and PCR. The sequences of forward detection primers BREV174F and ANEU506F were 5 -A GACCGGGATAACATAGGGAAACTTAT-3 and 5 -GAACCGCCGGGAT GACCTCCCGGTC-3 , respectively. The sequence of reverse primer 1377R was 5 -GGCATGCTGATCCGCGATTACTAGC-3 ; this sequence covered the conserved region of the 16S rRNA gene at positions 1401 to 1377. The primers were designed by considering aligned sequences of the 16S rRNA gene. Approximately 0.2 ng of chromosomal DNA was subjected to a PCR in a 25- l (total volume) reaction mixture containing 0.1 U of Taq DNA polymerase (Pharmacia Biotech, Uppsala, Sweden), 2.5 l of 10 Taq DNA polymerase buffer (Pharmacia Biotech), 4.0 l of a 1.25 mM deoxynucleoside triphosphate solution, and 0.25 l of a solution containing forward and reverse primers at a concentration of 0.1 mM. The procedure used involved 1 cycle of denaturation for 0.5 min at 94 C, 25 cycles consisting of denaturation for 1.0 min at 94 C, annealing for 1.5 min at 58 C, and extension for 1.5 min at 72 C, and 1 cycle of extension for 5.0 min at 72 C. The PCR products were analyzed by electrophoresis on a 1.2% agarose gel with TAE buffer (26). Nucleotide sequence accession numbers. The 16S rRNA gene sequences determined in this study have been deposited in the DDBJ-EMBL-GenBank database under the accession numbers shown in Table 1.
D78457 D78454 D78458 D78459 D78463 D78464 D78460 D78456 D78461 Z26921 D78455 D78462 D82062
pdf
Spiroplasma corruscae sp. nov., from a firefly beetle (Coleoptera: Lampyridae) and tabanid flies (Diptera: Tabanidae) -- Hackett et al. 46 (4): 947 -- International Journal of Systematic and Evolutionary Microbiology
strain TATS-1 from Tabanus atratus (gut contents); strain TC-1 from Tabanus calens (gut contents); isolates TG-1 (gut contents) and TG-2 (hemocoel contents) from Tabanus gladiator; strain TS-1 (gut contents) and isolates TS-2 (gut contents) and TS-2B (hemocoel contents) from Tabanus sulcifrons; and isolates from the gut contents and blood of three Tabanus sulcifrons specimens (Insect Biocontrol Laboratory accession numbers 00153, 00161, and 00187) (7, 17, 40). Isolates were also obtained from tabanid species from Georgia north to Maryland, including Chlorotabanus crepuscularis, Tabanus lineola, Tabanus melanocerus, Tabanus molestus, Tabanus nigripes, Tabanus petiolatus, and Tabanus trimaculatus (11, 12, 38, 40), as well as from insects from South Dakota (Tabanus sulcifrons [40]) and France (Chrysops viduatus, Hybomitra bimaculata, and Tabanus bromius) (22, 23). Spiroplasmas sometimes occurred in mixed infections in tabanids (38, 39), whereas spiroplasmas, mesoplasmas, and entomoplasmas occurred in mixed infections in the beetle Ellychnia corruscae (17, 19). Entomoplasma ellychniae (32) appears to be regularly associated with Ellychnia corrusca. Compared with other groups of insects (17, 18), a very high proportion of tabanid specimens was infected with spiroplasmas, with the frequencies of infection commonly exceeding 50% (11). In one estimate of the number of group XIV spiroplasmas in tabanid gut viscera, a titer of 105 cells was obtained, which is typical for estimates of the titers of other spiroplasmas in tabanid guts (11). Several hypotheses have been offered to explain the occurrence of group XIV spiroplasmas in both tabanid flies and firefly beetles. One of these hypotheses (17) involves possible transmission of spiroplasmas on flower surfaces, which may be visited by adult tabanids and lampyrids. The existence of a spiroplasma transmission cycle involving exposed host plant surfaces is supported by evidence which shows that (i) the spiroplasma persists for up to 30 days on leaf surfaces (36), (ii) transmission is affected by weather, particularly rainfall (11), and (iii) spiroplasmas are transmitted from infected Ellychnia corruscae adults to tabanid flies at feeding sources under laboratory conditions (36). A second hypothesis (17) is that larvae of members of the two groups, both of which are predaceous, may acquire group XIV spiroplasmas during foraging activities. However, there is no experimental evidence for this. Transmission among lampyrid or tabanid larvae has not been attempted. In limited sampling of lampyrid and tabanid larvae, group XIV spiroplasmas were not isolated. Nevertheless, other spiroplasmas have been isolated from lampyrid beetle larvae (19, 36), and entomoplas-
pdf
Actinobacillus minor sp. nov., Actinobacillus porcinus sp. nov., and Actinobacillus indolicus sp. nov., three new V factor-dependent species from the respiratory tract of pigs -- Moller et al. 46 (4): 951 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Bacterial strains. A total of 28 strains were included in this study. Table 1 shows the sources of 22 V-factor dependent porcine strains belonging to the Pasteurellaceae, the type strains of the type species of the genera Actinobacillus, Pasteurella, and Haemophilus (Actinobacillus lignieresii, Pasteurella multocida, and Haemophilus influenzae), and the type strains of species commonly isolated from pigs (A. pleuropneumoniae, Actinobacillus suis, and H. parasuis). Two taxon C strains described by Kilian (12) were included because of their V factor dependence and their presumed porcine origin. All of the strains were stored as lyophilized cultures. Phenotypic characteristics of the 22 porcine strains have been described elsewhere (15). The bacteria used for DNA preparation were propagated in 2.5-liter portions of brain heart infusion broth (Difco Laboratories, Detroit, Mich.) supplemented with 10 mg of NAD per liter. Each inoculated broth preparation was incubated for 48 h in air at 37 C. The two strains belonging to taxon E failed to grow in brain heart infusion broth and consequently were grown on chocolate agar plates; for each of these strains 40 plates were incubated for 48 h at 37 C. Preparation of DNA for DNA-DNA hybridization. The bacteria were harvested by centrifugation at 8,000 g for 10 min. The pellet from each 2.5-liter culture was suspended in 120 ml of distilled water containing 0.05 M Tris, 0.05 M EDTA, and 0.1 M NaCl (pH 8.0). The bacteria harvested from each group of 40 chocolate agar plates were suspended in 120 ml of the same solution. The cells were lysed in 2.6 ml of a 25% (wt/vol) aqueous solution of sodium dodecyl sulfate (Sigma Chemical Co., St. Louis, Mo.) and 0.4 ml of a 2% (wt/vol) pronase (Calbiochem-Behring, La Jolla, Calif.) solution. Each mixture was vigorously shaken and incubated at 37 C overnight. DNA was extracted and purified from the cell lysate by a previously described procedure (3). The DNAs in the solutions were sheared by sonication, dialyzed overnight against 0.042 M NaCl, and stored at 4 C over a layer of chloroform. DNA-DNA hybridization. Native DNA was labeled in vitro by nick translation (3). The S1 nuclease-trichloroacetic acid procedure was used for hybridization (9). Labeled DNA (about 10 ng) and unlabeled DNA (75 g) were heat denatured, the NaCl concentration of the preparation (final volume, 0.5 ml) was adjusted to 0.42 M, and the preparation was incubated at 60 C for 16 h. The Tm (the temperature at which 50% of the reassociated DNA became hydrolyzable by S1 enzyme treatment) was determined for some of the isolates. The Tm (the difference between the Tm of a homologous reaction and the Tm of a heterologous reaction) was used to estimate the level of divergence between two organisms (2). 16S rDNA sequencing. Chromosomal DNA was extracted as described by Christensen et al. (5). The 16S rDNA was amplified by PCR and sequenced by the cycle sequencing method (10). Programs for data entry, editing, sequence alignment, secondary-structure comparison, similarity matrix generation, and phylogenetic tree construction were written in Microsoft QuickBASIC for use on IBM PC-AT and compatible computers (6). Similarity matrices were constructed from aligned sequences by using only those sequence positions for which 90% of strains had data. Similarity matrices were corrected for multiple base changes by the method of Jukes and Cantor (11). The neighbor-joining method of Saitou and Nei (21) was used for phylogenetic tree construction. Determination of G C content of the DNA. The G C contents of three DNA samples were determined by O. Bouvet (Institut Pasteur, Paris, France). DNA was hydrolyzed with P1 nuclease (8). The nucleotides produced were separated by high-performance liquid chromatography as described by Perrone and Brown (19). The G C content was determined from the nucleotide ratios by using hydrolyzed bacteriophage lambda DNA as the standard. Nucleotide sequence accession numbers. The nucleotide sequences of the three bacterial strains examined in this study are available for electronic retrieval from the EMBL, GenBank, and DDBJ databases under the following accession type strain), U65582; strain NM319T, U65583; numbers: strain NM305T (T and strain 46KC2,T U65584.
U65582 U65583 U65584
pdf
Phylogeny of oral asaccharolytic Eubacterium species determined by 16S ribosomal DNA sequence comparison and proposal of Eubacterium infirmum sp. nov. and Eubacterium tardum sp. nov -- Cheeseman et al. 46 (4): 957 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Eubacterium brachy ATCC 33089T (T type strain), Eubacterium nodatum ATCC 33099T, Eubacterium saphenum ATCC 49989T, and Eubacterium timidum ATCC 33093T were obtained from the American Type Culture Collection. Strain W1471, a representative of the unnamed taxon cluster 1 (23), and strain 87K, a representative of the taxon New 1 (4), had been previously isolated from patients with periodontitis. A metabolic end product analysis was performed as described previously (23). Enzyme profiles were generated with a Rapid ID32A kit (BioMerieux) according to the manufacturer's instructions. Biochemical tests were performed by standard methods as described previously (22). Genomic DNA was isolated as follows (1). Bacterial cells were harvested from two plates containing Fastidious Anaerobe Agar (LabM) supplemented with 5% sheep blood following 96 h of anaerobic incubation and were suspended in 310 l of HTE buffer (50 mM Tris HCl, 20 mM disodium EDTA; pH 8). The resulting suspension was incubated at 70 C overnight and then snap-thawed at 50 C. Then 350 l of HTE buffer containing 2% (vol/vol) sarcosyl was added, and the preparation was vortex mixed. A 5- l portion of RNase was added, and the solution was incubated at 37 C for 15 min; 100 l of a 10-mg/ml proteinase K solution in TNE (10 mM Tris HCl, 10 mM NaCl, 0.1 mM disodium EDTA; pH 8) was added, and the preparation was incubated at 50 C for 90 min. Then 85 l of a solution containing 100 mg of hexadecyltrimethylammonium bromide per ml and 51.25 mg of NaCl per ml was added; the resulting solution was vortex mixed and incubated at 65 C for 20 min. An equal volume of chloroform was added, and the mixture was centrifuged at 13,000 g for 12 min. The top layer was removed and added to 600 l of isopropanol, and the resulting preparation was incubated overnight at 20 C. The DNA was pelleted by centrifugation at 13,000 g for 12 min, washed in 80% isopropanol, air dried, resuspended in 200 l of sterile distilled water, and stored at 20 C. The 16S rRNA gene was amplified by PCR with different combinations of eubacterial conserved primers 27F, 1392R, and 1492R (11). The PCR were performed with Taq polymerase (Boehringer Mannheim) according to the manufacturer's instructions, except that 2 mM MgCl2 was used. The PCR products were cloned with a TA cloning kit (InVitrogen) according to the manufacturer's instructions. Plasmids were prepared for sequencing by using Magic miniprep plasmid DNA isolation kits (Promega) according to the manufacturer's instructions. Sequencing was performed with an ALF automated sequencer (Pharmacia LKB) according to the manufacturer's instructions. The sequences which we determined were connected by using DNASIS (Hitachi) and were aligned with each other and with the sequences of related species by using Clustal V (7). Further analysis was performed by using the PHYLIP suite of programs (6). Specifically, DNADIST was used to compare sequences by the Jukes-Cantor algorithm, and NEIGHBOR was used for a neighbor-joining cluster analysis. Estimation of G C content. The bacteria were grown in brain heart infusion medium (Lab M) supplemented with 0.2% arginine. The cells were harvested by centrifugation and then suspended in a solution containing 12.5 ml of 0.15 M sodium chloride50 mM disodium EDTA per g of cell pellet supplemented with 5 mg of proteinase K at 37 C for 1 h. After 0.1 volume of 20% (wt/vol) sodium dodecyl sulfate was added and the preparation was incubated for 1 h at 37 C, phenol, phenol-chloroform, and chloroform extractions were performed, and the DNA was then precipitated with ethanol. The DNA pellets were washed in 70% ethanol, resuspended in 0.1 SSC (1 SSC is 0.15 M NaCl plus 15 mM sodium citrate [pH 7]), and dialyzed against 0.1 SSC overnight. DNA thermal melting points were determined by using a temperature-programmable spectrophometer (2), and the G C contents were calculated by using standard methods (17). Nucleotide sequence accession numbers. The nucleotide sequences determined in this study have been deposited in the EMBL database under the following accession numbers: Eubacterium timidum ATCC 33093T, U13042; Eubacterium brachy ATCC 33089T, U13038; Eubacterium nodatum ATCC 33099T,
U13042 U13038
pdf
Phylogeny of Prosthecobacter, the fusiform caulobacters: members of a recently discovered division of the bacteria -- Hedlund et al. 46 (4): 960 -- International Journal of Systematic and Evolutionary Microbiology
was defined as the lowest antibiotic concentration which completely prevented growth. Nucleotide sequence accession numbers. The 16S rDNA sequences of Prosthecobacter sp. strains FC1, FC2, FC3, and FC4T have been deposited in the GenBank database under accession numbers U60012, U60013, U60014, and U60015, respectively.
U60012 U60013 U60014 U60015
pdf
Leucobacter komagatae gen. nov., sp. nov., a new aerobic gram-positive, nonsporulating rod with 2,4-diaminobutyric acid in the cell wall -- Takeuchi et al. 46 (4): 967 -- International Journal of Systematic and Evolutionary Microbiology
netic tree was constructed by the neighbor-joining method (20). The topology of the phylogenetic tree was evaluated by the bootstrap resampling method of Felsenstein (5) with 1,000 replicates. Nucleotide sequence accession numbers. The sequences which we determined were aligned with previously published sequences that have been deposited in the DDBJ, GenBank, and EMBL data libraries under the following accession numbers: Agrococcus jenensis, X92492; Agromyces cerinus subsp. cerinus, D45060; Agromyces fucosus subsp. hippuratus, D45061; Agromyces mediolanum, X77449; Agromyces ramosus, X77434; Arthrobacter globiformis, M23411; Aureobacterium liquefaciens, X77437; Aureobacterium testaceum, X77438; Brevibacterium linens, X77440; Clavibacter michiganense subsp. insidiosus, D45051; Clavibacter michiganense subsp. michiganense, X77441; "Corynebacterium aquaticum," X77443; Curtobacterium citreum, X77445; Kineococcus aurantiacus (25, 31), D17527; Microbacterium arborescens, D21339; Microbacterium lacticum, D21343; Micrococcus luteus, M38242; Rathayibacter rathayi, X77450; Rathayibacter tritici, X77438; and Renibacterium salmoninarum, X51601. The nucleotide sequence of IFO 15245T has been deposited in the DDBJ database under accession number D17751.
X92492 D45060 D45061 X77449 X77434 M23411 X77437 X77438 X77440 D45051 X77441 X77443 X77445 D17527 D21339 D21343 M38242 X77450 X77438 X51601 D17751
pdf
Sinorhizobium medicae sp. nov., isolated from annual Medicago spp -- Rome et al. 46 (4): 972 -- International Journal of Systematic and Evolutionary Microbiology
Clustal multiple-alignment program (13). Sites involving gaps were excluded from all analyses. Evolutionary distances corrected for multiple substitutions were computed by using Kimura's two-parameter model (17). A phylogenetic tree was inferred by using the neighbor-joining (NJ) method (23). The NJ method is considered one of the most efficient methods for recovering phylogenetic trees (23). The 16S rRNA sequences of the following organisms belonging to the Rhizobiaceae and related bacteria were used for comparison (GenBank accession numbers are in parentheses): Rhizobium ciceri UPM-Ca7T (UO7934), Rhizobium galegae LMG 6214T (X67226), Rhizobium huakuii IAM 14158T (D12797), Rhizobium leguminosarum A LMG 9518 (X67233), Rhizobium loti A LMG 6125T (X67229), Rhizobium loti B LMG 4284 (X67230), Rhizobium mediterraneum UPM-Ca36T (L38825), Rhizobium tropici (IFO15247) (D11344), Rhizobium tropici IIB LMG 9517 (X67234), Rhizobium ORS 1001-Cluster U (X68389), Rhizobium sp. strain LMG 9509 (X67232), S. meliloti LMG 6133T ( ATCC 9930T) (X67222), S. fredii LMG 6217T ( USDA 205T) (X67231), S. teranga ORS 1009T (X68387), S. saheli ORS 609T (X68391), Bradyrhizobium japonicum NZP 5549T (X66024), Azorhizobium caulinodans LMG 6465 (X67221), Agrobacterium rhizogenes LMG 150T (X67224), Agrobacterium rubi ATCC 13335T (D14503 and D01259), Agrobacterium tumefaciens LMG 198T (X67223), Agrobacterium vitis LMG 257 (D14502 and D1258), Brucella abortus (X13695), Mycoplana dimorpha NCIB 9439T (D12786), Ochrobactrum anthropi CIP 14970T (D12794), Phyllobacterium myrsinacearum NCIB 12127 (D12789), and Rochalimaea vinsonii (M73230). Phenotypic tests (i) Growth characteristics. In order to determine the capacity of the organisms to grow at different pH values and temperatures and their tolerance to sodium chloride, starter cultures were grown at 28 C to the log phase (109 bacteria per ml) in YEM broth, and 5-ml portions of YEM broth were inoculated in triplicate with 50- l portions of the starter cultures. The presence or absence of growth was scored in inoculated tubes after 3 days. The pH tolerance of strains was determined by using YEM broth preparations in which the pH values were adjusted to 4.0, 5.0, 6.0, 9.0, and 10 ( 0.1 pH unit) by adding HCl or NaOH. Growth was also examined at 37 and 42 C. Sodium chloride tolerance was determined by using YEM broth preparations in which the concentrations of NaCl were 2 and 3% (wt/vol). Control cultures were grown under standard conditions in YEM medium (0.1% [wt/vol] NaCl, pH 7, 28 C). (ii) Antibiotic susceptibility. Triplicate antibiotic resistance tests were performed by measuring the diameters of inhibition zones on YEM agar plates containing the following antibiotic discs: polymyxin (300 mg), streptomycin (10 mg), tetracycline (30 mg), neomycin (30 mg), chloramphenicol (30 mg), nalidixic acid (30 mg), vancomycin (30 mg), and penicillin G (6 mg) (SANOFI Diagnostic Pasteur, Marnes-la-Coquette, France). The susceptibilities of the strains were deduced from the antibiograms (SANOFI Diagnostic Pasteur) on the basis of the diameters of the inhibition zones. (iii) Biochemical and auxanographic tests. A total of 49 carbohydrates were used as sole carbon sources in API 50CH microtube system rapid procedures (BioMerieux, La Balme Les Grottes, France). The preparations were inoculated ´ as recommended by the manufacturer, and the test strips were incubated at 28 C. Results were scored every day for 5 days. (iv) Data analysis. The genetic distance between each possible pair of isolates tested for auxanographic and biochemical characteristics was estimated by comparing the phenotypic variables, using the Jaccard similarity coefficient (26). In this procedure the sum of effective matches is computed and divided by the total
X67226 D12797 X67233 X67229 X67230 L38825 D11344 X67234 X68389 X67232 X67222 X67231 X68387 X68391 X66024 X67221 X67224 D14503 D01259 X67223 D14502 X13695 D12786 D12794 D12789 M73230
pdf
Oxidation of thiosulfate by a new bacterium, Bosea thiooxidans (strain BI-42) gen. nov., sp. nov.: analysis of phylogeny based on chemotaxonomy and 16S ribosomal DNA sequencing -- Das et al. 46 (4): 981 -- International Journal of Systematic and Evolutionary Microbiology
ratio, 100:1; injection volume, 2 ml; and temperature program, 170 to 270 C, with the temperature increasing at a rate of 5 C/min. Isolation and amplification of 16S rDNA. Genomic DNA was extracted and 16S rDNA was amplified by the method of Rainey et al. (30). The PCR to amplify the 16S rDNA was performed by using primers 5 -GAGTTTGATCCT GGCTCAG-3 (forward primer) and 5 -AGAAAGGAGGTGATCCAGCC-3 (reverse primer) as described by Stackebrandt and Charfreitag (40). The PCR products were sequenced directly by using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.) and a model 373A DNA sequencer (Applied Biosystems). 16S rDNA sequence analysis. The 16S rDNA sequence which we determined was manually aligned with previously published sequences obtained from the Ribosomal Database Project for members of the actinomycete line of descent as described by Maidak et al. (24). Pairwise evolutionary distances were computed by using the corrections of Jukes and Cantor (12). A more detailed analysis was carried out with the organisms which were found to be most closely related to BI-42. Trees were reconstructed as described by De Soete (5). Preparation of extract. The cell extract used for enzyme assays was prepared by harvesting cells at the mid-exponential phase and then washing and resuspending the resulting cell pellet in 10 mM KPO4 buffer (pH 7.0) containing 1 mM EDTA (disodium salt) and 7 mM 2-mercaptoethanol for the GDH and GOGAT assays and in 100 mM Tris-HCl buffer (pH 8.2) containing 20 mM MgCl2, 5 mM NaHCO3, and 0.5 mM dithiothreitol for the RuBP carboxylase assay. The cells were sonicated with a Braunsonic 1510 sonicator six times (30 s each) at 150 W in an ice bath. The cell debris was removed by centrifugation at 28,000 g for 30 min, and the supernatant was used as the enzyme source. For the GS assay, 10 ml of exponentially growing cells was treated with cetyltrimethylammonium bromide (0.1 g/liter) and then shaken thoroughly for 3 min. The treated cultures were chilled immediately and centrifuged at 4 C, and the resulting preparations were washed and resuspended in 1 ml of an ice-cold KCl solution (10 g/liter). These cell suspensions were used for the GS activity assay. Enzyme assays. GDH activity was measured by the method of Maulick and Ghosh (26). The 1-ml reaction mixture used for the NADPH-dependent assay contained 50 mM Tris-HCl buffer (pH 8.5), 50 mM NH4Cl, 1 mM 2-oxoglutarate, 0.1 mM NADPH, and the cell extract. The assay was performed at 30 C by measuring the rate of oxidation of NADPH at 340 nm with a Shimadzu UVvisible recording spectrophotometer (model UV 240). Similarly, the NADHdependent GDH activity was measured by replacing NADPH with 1 mM NADH and increasing the concentration of 2-oxoglutarate to 10 mM. After incubation for 3 min at 30 C, the reaction was stopped by adding 6.5 ml of 100 mM NaOH, and the A340 was determined. The oxidative deamination of glutamate by GDH was assayed by measuring the formation of NADPH at 340 nm by using an assay mixture containing 100 mM Tris-HCl (pH 8.8), 25 mM glutamate, and 0.5 mM NADP in a final volume of 1 ml. GOGAT activity was measured by using 2-ketoglutarate and determining glutamine-dependent oxidation of NADPH as described by Meers et al. (27). GS activity was measured by the -glutamyl transferase method described by Miller et al. (28). In every case, the -glutamyl transferase activities in the presence and absence of 60 mM MgCl2 were measured to determine the active state of the enzyme. The reaction mixture was incubated for 10 min at 30 C, and the amount of -glutamyl hydroxymate formed was determined at 535 nm by using a reagent blank for comparison. Specific activity was expressed as the amount of enzyme which catalyzed the formation or disappearance of 1 mol of product or substrate per min. The RuBP carboxylase activity in the cell extract was determined as described by Kelly et al. (16). The final volume of the assay mixture, which contained cell extract (0.1 to 0.4 g of protein), was 0.3 ml. The reaction was initiated with RuBP and was terminated after 0.5, 1, 1.5, 2, 3, and 4 min by adding 0.2 ml of acetic acid. Zero-time and RuBP-free controls were included. Each reaction mixture was dried in its vial, 5 ml of scintillation fluid, which contained 10 g of 2,5-diphenyloxazole per liter, 0.25 g of 1,4-bis(5-phenyl-2-oxazolyl)benzene (POPOP) per liter, and 100 g of naphthalene per liter in 1,4-dioxane, was added, and 14CO2 incorporation was determined with a Beckman scintillation counter. Analytical methods. DNA base composition was determined by the thermal denaturation method of Marmur and Doty (25). The growth of cells was monitored by measuring optical density at 660 nm. Protein contents were estimated by using the method of Lowry et al. (22) and bovine serum albumin as the standard. The concentrations of thiosulfate and tetrathionate in culture filtrates were determined as described by Kelly et al. (15). The sulfite content was determined by the method of Truper and Schlegel (49), as modified by Suzuki and Silver (45). The sulfate content was determined by the method of Berglund and Sorbo (1) and by the method of Gleen and Quastel (7); since a concentration of thiosulfate greater than 2.0 mol/5 ml of reaction mixture interfered with the sulfate determination when the first method was used, the second method was always used to confirm the results. Nucleotide sequence accession number. The 16S rDNA sequence of strain BI-42 has been deposited in the EMBL data library under accession number X81044.
X81044
pdf
A polyphasic reassessment of the genus Paenibacillus, reclassification of Bacillus lautus (Nakamura 1984) as Paenibacillus lautus comb. nov. and of Bacillus peoriae (Montefusco et al. 1993) as Paenibacillus peoriae comb. nov., and emended descriptions of P. lautus and of P. peoriae -- Heyndrickx et al. 46 (4): 988 -- International Journal of Systematic and Evolutionary Microbiology
B14750
pdf
Analysis of the beta' subunit of DNA-dependent RNA polymerase does not support the hypothesis inferred from 16S rRNA analysis that Oenococcus oeni (formerly Leuconostoc oenos) is a tachytelic (fast-evolving) bacterium -- Morse et al. 46 (4): 1004 -- International Journal of Systematic and Evolutionary Microbiology
EVOLUTION OF O. OENI TABLE 1. Bacterial strains used and their rpoC gene sequence accession numbers
X95811 X95810 X95812 X96384 X96470 X95813 X96385
pdf
Isolation and characterization of Desulfitobacterium frappieri sp. nov., an anaerobic bacterium which reductively dechlorinates pentachlorophenol to 3-chlorophenol -- Bouchard et al. 46 (4): 1010 -- International Journal of Systematic and Evolutionary Microbiology
dechlorinate PCP to 3-CP. One of the strains isolated was purified by subculturing it on Columbia solid medium. The purity of this culture was checked by photonic microscopy after Gram staining and by examining the colonies on solid medium. Culture conditions and characterization of PCP-1T. Whether strain PCP-1T could grow with different organic substrates or vitamins was determined by adding the following compounds to mineral salt medium containing 2% (vol/vol) DEAE-Sephacel beads: 20 and 55 mM pyruvate, 0.02 and 0.1% (wt/vol) yeast extract, 100 g of hemin per liter, and 200 g of 1,4-naphthoquinone per liter. Some biochemical properties of PCP-1T were determined by using the anaerobic API 20E system (Bio-Merieux, Montreal, Canada). Different electron acceptors ´ were tested by adding 10 mM Na2SO4, 5 mM Na2SO3, 10 mM Na2S2O3, or 10 mM KNO3 to culture medium containing 55 mM pyruvate, 0.02% yeast extract, and 2% DEAE-Sephacel beads. In this experiment, cysteine-HCl (2 mM) was used as the reducing agent instead of Na2S. pH and temperature ranges for growth. The pH and temperature ranges for growth of strain PCP-1T were determined by monitoring the increase in optical density at 660 nm in culture medium containing 55 mM pyruvate, 0.1% yeast extract, and 5 mM Na2SO3. Media having pH values ranging from 6.0 to 9.0 were prepared by varying the acid and base components of the buffer. The pH was kept constant by frequently adjusting it with sterile 2 N NaOH. The pH range for growth was determined at 37 C. The temperature range for growth was determined in pH 7.2 culture medium incubated at 15, 20, 29, 37, 40, and 45 C. Assays were performed in duplicate. Sensitivity to oxygen. The sensitivity of bacterial growth and dechlorination of 2,4,6-trichlorophenol to oxygen was determined in 120-ml serum bottles containing 20 ml of culture medium which contained no reducing solution. The medium was prepared under a gas mixture containing 80% N2, 10% H2 and 10% CO2. A volume of air corresponding to 0, 1, 2, 5, and 10% of the headspace volume was added to the gas mixture. Each bottle was inoculated with 1.0 ml of a PCP-1T culture in the exponential growth phase. The bottles were incubated in a shaking incubator at 37 C for 8 days. Analytical procedure. The different chlorophenols were analyzed routinely by high-pressure liquid chromatography (HPLC), using a reverse-phase NovaPak C18 column (3.9 by 150 mm). The Waters system used comprised a model 510 pump connected to a model 481 Lambda-Max Lc spectrophotometer and a model Professional 350 Digital computer. Some chlorophenol degradation intermediates were identified with a gas chromatograph (Varian model 3500) connected to a mass spectrometer (Ion trap 800; Finnigan Mat). The HPLC and gas chromatography-mass spectrometry operating parameters used have been described previously (11, 12). Electron microscopy. The morphology of PCP-1T was determined with a Hitachi model 7100 electron microscope after negative staining with 1% phosphotungstate as described by Alain et al. (1). Ultrathin sections were also prepared. Bacteria were fixed by incubating them for 15 min at room temperature with 2.5% (vol/vol) glutataldehyde in 0.05 M cacodylate buffer (pH 7.2). The cells were pelleted by centrifugation in an Eppendorf tube at 1,300 rpm (15,000 g) for 3 min and washed three times with a 3% (wt/vol) sucrose solution in cacodylate buffer. The cell pellets were then postfixed with 2% (wt/vol) osmium tetroxide, dehydrated in acetone, and embedded in Spurr resin. Ultrathin sections were stained with 5% (wt/vol) uranyl acetate for 20 min and then with lead citrate for 5 min before they were examined. Determination of G C content. The guanine-plus-cytosine (G C) content was determined after enzymatic digestions with nuclease P1 and alkaline phosphatase and HPLC separation of nucleosides as described by Mesbah et al. (17). DNA manipulation. Extraction of total PCP-1T DNA, PCR amplification of the 16S ribosomal gene, cloning and sequencing of the gene, and a sequence analysis were performed as described by Li et al. (14). Briefly, the 16S ribosomal gene was amplified by PCR by using universal eubacterial primers (4) and strain PCP-1T genomic DNA. The resulting 1.6-kbp DNA fragment was then cloned in the Bluescript vector (Stratagene) and sequenced by the dideoxynucleotide method (21). The PCP-1T sequence was compared with sequences obtained from databases by using the FASTA and BLAST programs. Phylogenetic analyses were performed by using different programs of the PHYLIP package (version 3.5) (10) and the most closely related species (see Table 1 and Fig. 5). The secondary structure of minimum free energy for an RNA molecule based on previously published values for stacking and loop-destabilizing energies was calculated by using the FOLD program (25) of the GCG sequence analysis package (Genetics Computer Group, Inc.). Dechlorination of different chlorophenols. Experiments to determine whether various chlorophenols were dechlorinated were performed in serum bottles containing 25 ml of mineral salt medium supplemented with 20 mM pyruvate, 0.02% (wt/vol) yeast extract, and 2% (vol/vol) DEAE-Sephacel; 2.5 ml of an active culture was used as the inoculum in each experiment. The chlorophenols were added 24 h after inoculation at concentrations of 5 mg/liter (21 M) for the tetrachlorophenols and 3 mg/liter (16 to 23 M) for the other chlorophenols. In some experiments, 3 mg of PCP per liter (11 M) was also added to the culture to induce dechlorinating activity. The cultures were incubated at 29 C. Triplicate preparations were analyzed by HPLC at zero time and on days 1, 2, 4, and 8. Nucleotide sequence accession number. The GenBank accession number for the 16S rRNA sequence of Desulfitobacterium frappieri PCP-1T is U40078.
U40078
pdf
Classification of bacteria nodulating Lathyrus japonicus and Lathyrus pratensis in northern Quebec as strains of Rhizobium leguminosarum biovar viciae -- Drouin et al. 46 (4): 1016 -- International Journal of Systematic and Evolutionary Microbiology
CCTCCCGTAGGAGT-3 ) corresponded to Escherichia coli positions 20 to 43 and 361 to 338, respectively. The PCR was carried out as follows: 30 cycles, with 1 cycle consisting of 30 s at 95 C for denaturation, 30 s at 55 C for primer annealing, and 3 min at 72 C for extension. A hot start step preceded the first cycle and consisted of 2 min of denaturation at 95 C, 30 s at 55 C, and 2 min at 72 C after which the polymerase was added. The products were visualized on 1% agarose gel, and the 310-bp band was excised from the gel and incubated in 1 ml of TE buffer overnight at 4 C. This solution was used for an asymmetric PCR with three primer dilutions (1/50, 2/50, and 3/50) to allow the amplification of a single-stranded product. The amplification was done as described above but with 35 cycles. The asymmetric PCR products were purified by using the Magic PCR Preps DNA purification system (Promega) as recommended by the manufacturer. Both strands of three to four independent single-stranded PCR products were sequenced with Sequenase (5). The sequences were aligned with 18 known sequences of different species by using the program PILEUP (Genetics Computer Group Sequence Analysis). The following sequences were obtained from GenBank (accession number given in parentheses): Agrobacterium tumefaciens DMS 30105 (M11223), Azorhizobium caulinodans ORS 571 (M55491), Bradyrhizobium japonicum USDA 110 (M55485), Bradyrhizobium sp. strain BTAi1 (M55492) and NZP 2257 (M55486), R. etli OLIVIA (M55235), Rhizobium fredii IAM 14142 (D12796), Rhizobium huakuii IAM 14158 (D12797), R. leguminosarum 162Y13 (M55240), R. leguminosarum bv. phaseoli 8002 (M55494) and FL27 (M55234), Rhizobium loti NZP 2213 (X63823), Rhizobium meliloti ATCC 9930 (M55241) and CC169 (M55242), Rhizobium sp. (isolated from Medicago sativa and Phaseolus vulgaris) OR191 (M55236), and R. tropici CIAT 899 (M55233). Nucleotide sequences of R. leguminosarum bv. trifolii (USDA 2046) and R. leguminosarum bv. viciae (USDA 2370) were obtained from the U.S. Department of Agriculture. Phylogenetic relationships were determined by parsimony analysis performed with an heuristic search algorithm on all sequences followed by a 500-replication bootstrap analysis using the program PAUP (22). Nucleotide sequence accession numbers. The ribosomal gene sequences of strain Lj 3 isolated from L. japonicus and strain Lp 1013 isolated from L. pratensis have been deposited in GenBank/EMBL nucleotide sequence database under the accession numbers U08100 and U08101, respectively.
M11223 M55491 M55485 M55492 M55486 M55235 D12796 D12797 M55240 M55494 M55234 X63823 M55241 M55242 M55236 M55233 U08100 U08101
pdf
Thermobrachium celere gen. nov., sp. nov., a rapidly growing thermophilic, alkalitolerant, and proteolytic obligate anaerobe -- Engle et al. 46 (4): 1025 -- International Journal of Systematic and Evolutionary Microbiology
by using a 0.008 N H2SO4 mobile phase at a flow rate of 0.6 mm/min and a model 156 refractive index detector (ALTEX, San Ramon, Calif.). Whole-cell protein pattern (sodium dodecyl sulfate [SDS]-polyacrylamide gel electrophoresis [PAGE]). The strains were grown in Hungate tubes containing 10 ml of prereduced medium M-5 (see above) containing 0.5% yeast extract, 0.25% tryptone, and 0.5% (wt/vol) filter-sterilized glucose. Duplicate cultures were incubated at 60 C until the OD600 values were 0.2 and 0.4 (early and late exponential growth phases) for each strain. The cultures were immediately centrifuged at 8,000 g for 20 min to pellet the cells. The pellets from cultures at each OD600 were combined, resuspended in 4.0 ml of 0.125 M Tris HCl buffer (pH 7.0), and frozen at 20 C until they were lysed. Cells were lysed by passing them through a chilled French pressure cell (catalog no. 4-3399; Aminco) at g for 20 min to 17,000 lb/in2. The resulting lysates were centrifuged at 8,000 remove whole cells and debris and were frozen at 20 C until they were electrophoresed. For electrophoresis, SDS-polyacrylamide separating gels (thickness, 1 mm) containing 10% acrylamide and 4% acrylamide stacking gels were cast and electrophoresed in a Bio-Rad Mini Protean II system at 150 V for approximately 1.5 h. High-molecular-weight standards for SDS were obtained from Pharmacia. Protein samples in 0.7-ml microcentrifuge tubes were diluted into denaturing loading buffer and heated in a boiling water bath for 20 min. Approximately 10 g of protein was loaded in each lane. The gels were stained with 0.1% (wt/vol) Coomassie brilliant blue R-250, dissolved in methanol-deionized water-acetic acid (9:9:2, vol/vol/vol) for at least 2 h and were destained in a solution containing 40% methanol and 10% acetic acid. 16S rDNA sequence determination and analysis. Genomic DNA was extracted and PCR-mediated amplification of the 16S rDNA was performed as described previously (24). Purified PCR products were sequenced with a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.) as recommended by the manufacturer. Sequence reaction mixtures were electrophoresed by using an Applied Biosystems model 373A DNA sequencer. The 16S rDNA sequences were aligned manually with the sequences of representatives of the genus Clostridium and related taxa. Pairwise evolutionary distances were computed by using the correction of Jukes and Cantor (11). Both the leastsquares distance method of De Soete (4) and the neighbor-joining method of Saitou and Nei (25) were used to construct phylogenetic dendrograms from distance matrices. A maximum-likelihood analysis was performed by using the PHYLIP package (6). Bootstrap values were calculated from 1,000 trees by using the programs NJFIND and NJBOOT. The reference sequences included in the analysis were obtained from the Ribosomal Database Project (18). Nucleotide sequence accession number. The 16S rDNA nucleotide sequence of strain JW/YL-NZ35T has been deposited in the EMBL database under accession number X99238.
X99238
pdf
Phenotypic and DNA relatedness between nematode symbionts and clinical strains of the genus Photorhabdus (Enterobacteriaceae) -- Akhurst et al. 46 (4): 1034 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Description of chlorophenol-degrading Pseudomonas sp. strains KF1T, KF3, and NKF1 as a new species of the genus Sphingomonas, Sphingomonas subarctica sp. nov -- Nohynek et al. 46 (4): 1042 -- International Journal of Systematic and Evolutionary Microbiology
Jukes and Cantor (21). The neighbor-joining method was used to reconstruct a phylogenetic tree from the distance matrices (44). DNA-DNA reassociation studies. DNA was isolated by chromatography on hydroxyapatite by the procedure of Cashion et al. (6). DNA-DNA reassociation experiments were performed as described by De Ley et al. (8), with the modifications described by Huss et al. (19), by using a Gilford System model 2600 spectrophotometer equipped with a model 2527-R thermoprogrammer and plotter (Gilford Instruments, Oberlin, Ohio). Renaturation rates were computed with the TRANSFER.BAS program (20). Oxidation of carbon sources. Oxidation of 95 different carbon sources was tested by using Biolog GN MicroPlates (Biolog, Inc., Hayward, Calif.) and an inoculum grown on Trypticase soy agar plates. Oxidation of individual carbon sources was detected indirectly by observing reduction of tetrazolium dye with Biolog GN MicroLog3 software after 24 h of incubation at 28 C. The ancillary program Mlclust (MicroLog3 software) was used to construct dendrograms. Additional substrate utilization characteristics were determined by using API ´ 20NE strips (Bio Merieux, Marcy-l'Etoile, France). ´ Protein profiles. Protein profiles were determined from whole-cell protein patterns as described previously (16, 35). The results were used to construct an unweighted pair group with mathematical average dendrogram (51). Nucleotide sequence accession numbers. The 16S rDNA sequences determined by us have been deposited in the EMBL database (Cambridge, United Kingdom) under the following accession numbers: KF1T, X94102; KF3, X94103; NKF1, X94104; Beijerinckia sp. strain B1, X94099; Pseudomonas sp. strain BN6, X94098; Alcaligenes sp. strain A175, X94101; and S. paucimobilis EPA 505, X94100. The sequences of the reference strains were obtained from the Ribosomal Database Project (29). The nucleotide sequence accession numbers for the reference strains are as follows: Sphingomonas adhaesiva JCM 7370T, X72720; Sphingomonas capsulata ATCC 14666T, M59296; Sphingomonas rosa IFO 15208T, D13945; Blastobacter natatorius ATCC 35951T, X73043; Rhizomonas suberifaciens IFO 15211T, D13737; Sphingomonas macrogoltabidus IFO 15033T, D13723; Sphingomonas terrae IFO 15098T, D13727; S. yanoikuyae IFO 15102T, X72725; S. paucimobilis ATCC 10829T (previously the type strain of Flavobac-
X94102 X94103 X94104 X94099 X94098 X94101 X94100 X72720 M59296 D13945 X73043 D13737 D13723 D13727 X72725
pdf
Sulfobacillus disulfidooxidans sp. nov., a new acidophilic, disulfide- oxidizing, gram-positive, spore-forming bacterium -- Dufresne et al. 46 (4): 1056 -- International Journal of Systematic and Evolutionary Microbiology
Genes coding for 16S rRNA (rDNA) fragments corresponding to the positions 8 to 1510 of E. coli 16S rDNA (6) were amplified by PCR. The later sequence was amplified in overlapping fragments with the three sets of primers described in Table 1. DNA amplification was conducted in a Perkin-Elmer Cetus GenAmp PCR System 9600 under the following conditions: a preheating cycle at 98 C for 1 min, followed by 30 amplification cycles with profiles for DNA denaturation, primer annealing, and primer extension steps of 98, 62, and 72 C for 10, 5, and 15 s, respectively; for the SSU 27-SSU 785 primer pair and 98, 55, and 72 C for 10, 5, and 15 s for the other two primer pairs. After 30 cycles, the reactions were stopped, and PCR products were purified by QIA quick-spin column chromatography (QIAGEN, Chatworth, Calif.). Both strands were sequenced with an ABI 372 automated sequencer with Taq dyedeoxy cycle sequencing (PE-ABI, Foster City, Calif.). The 16S rDNA sequence of strain SD-11 was first aligned with one of its most similar sequences, the 16S rDNA of S. thermosulfidooxidans by the ALIGNMENT procedure of the Ribosomal Database Project (24). The SD-11 sequence was aligned manually on the already available alignment of 16S rDNA sequences from 15 species, including S. thermosulfidooxidans, obtained from the Ribosomal Database Project (SUBALIGN procedure). Ambiguous regions (positions 1 to 225, 452 to 481, 998 to 1044, and 1510 to 1546) were removed, and the resulting alignment of 1,208 nucleotides was submitted to phylogenetic analyses. Standard parsimony analysis was conducted with the heuristic algorithm of PAUP, version 3.1.1 (34), in which minimal gaps were considered as missing values. Sequences were submitted in 100 different random orders. Pairwise sequence identities were also estimated and transformed in rates of substitution by the two-parameter method of Kimura (20), which takes into account transitions and transversions. The resulting matrix of substitution rates was submitted to neighbor-joining analysis (30) with MEGA, version 1.0 (21). Confidence levels for the tree topologies obtained were estimated by a bootstrap procedure (14) with 100 replicates for both parsimony (PAUP) and neighbor-joining analysis (MEGA). In all cases, the gram-negative E. coli, T. acidophilus, and T. thiooxidans were used as outgroups for rooting the gram-positive tree. Nucleotide sequence accession number. The 16S rDNA sequence of strain SD-11 obtained in this study has been deposited in the GenBank nucleotide sequence database under accession number U34974. The accession numbers used as reference sequences are as follows: Alicyclobacillus acidocaldarius, X60742; Alicyclobacillus acidoterrestris, X60743; Alicyclobacillus cycloheptanicus, X51928; Bacillus subtilis, K00637, M10606, and X00007; Clostridium innocuum, M23732; E. coli, J01695; Mycobacterium bovis, M20940; Sporolactobacillus inulinis, M58838; Streptomyces lividans, Y00484; strain ALV, M79375, M79376, and M80290; strain BC, M79380 to M79382; strain TH3, M79433 and M79434; Thiobacillus thiooxidans, X75269; and Thiobacillus acidophilus, M79399 and M79400.
U34974 X60742 X60743 X51928 K00637 M10606 X00007 M23732 J01695 M20940 M58838 Y00484 M79375 M79376 M80290 M79380 M79382 M79433 M79434 X75269 M79399 M79400
pdf
Phylogenetic positions of Desulfofustis glycolicus gen. nov., sp. nov., and Syntrophobotulus glycolicus gen. nov., sp. nov., two new strict anaerobes growing with glycolic acid -- Friedrich et al. 46 (4): 1065 -- International Journal of Systematic and Evolutionary Microbiology
Both strains were cultivated in a bicarbonate-buffered, sulfide- or cysteinereduced mineral medium (21, 30) which contained trace element solution SL10 (29), selenite-tungstate solution (29), and seven-vitamin solution (30). Details of cultivation and characterization are given in the original descriptions (9, 12). In vitro amplification and direct sequencing of 16S rRNA encoding DNA were performed as described earlier (24). The new sequences were added to an alignment of about 5,000 complete or partial 16S rRNA primary structures from bacteria (17, 27) by using the alignment tool of the ARB program package (25). Phylogenetic analyses were performed by applying the distance matrix (ARB, PHYLIP; 8), maximum-parsimony (ARB, PHYLIP), and maximum-likelihood (fastDNAml; 17) methods to different sets of data. Distance matrix and maximum-parsimony analyses were performed with sets of data comprising all available 16S rRNA primary structures from gram-positive bacteria with low-G C DNA (about 850 sequences) and the subclass of the class Proteobacteria (66 sequences), as well as selected reference sequences from each of the remaining major phylogenetic groups of bacteria. Maximum-likelihood methods were used to analyze subsets of about 50 sequences comprising the homologous sequences of the nearest neighbors of the organisms studied here and selected outgroup references from other phylogenetic groups. The sets of data varied with respect to the reference sequences, as well as the alignment positions included. The variabilities of the individual alignment positions were determined by using the respective tool of the ARB package and used as a criterion to successively remove highly variable positions from the set of data. This was done to recognize and minimize treeing artifacts resulting from alignment errors, database inconsistencies, and false identities (multiple base changes) in highly variable regions. Nucleotide sequence accession numbers. The 16S rRNA-encoding DNA sequences of strains PerGlyS and FlGlyR were entered into the Ribosomal Database under accession numbers 99707 and 99706, respectively.
pdf
Aeropyrum pernix gen. nov., sp. nov., a novel aerobic hyperthermophilic archaeon growing at temperatures up to 100 degrees C -- Sako et al. 46 (4): 1070 -- International Journal of Systematic and Evolutionary Microbiology
removed and recentrifuged at 105,000 g for 6 h to precipitate the ribosomes. The pellet was resuspended in buffer I and treated with RNase-free DNase I (Boehringer, Mannheim, Germany) at a concentration of 2 g/ml. rRNAs were obtained after three extractions with phenol-chloroform followed by two ethanol precipitations and separated by a 5 to 20% sucrose density gradient centrifugation at 100,000 g for 17 h (TST 28.38 rotor; Kontron Instruments, Milan, Italy). Fractions containing 16S rRNA were pooled. Purity of the 16S rRNA was checked electrophoretically. 16S rRNA analysis. A cDNA clone of the 16S rRNA was obtained after reverse transcription and PCR amplification. The oligonucleotide 1521R (5 -A GGTGATTCAGCCGCAGGTT), complementary to the 3 -tail conserved region of the archaeal 16S rRNA, was employed to prime first-strand synthesis with Superscript II RNaseH (GIBCO Laboratories, Grand Island, N.Y.). The reverse transcription reaction was performed according to the manufacturer's instructions, and the product was amplified by PCR with Arch21F (5 -TTCCG GTTGATCCYGCCGGA) (10) and 1521R as primers. Thirty-five amplification cycles of 90 s at 96 C, 1 min at 62 C, and 2 min at 72 C were performed. The double-stranded PCR product was cloned directly into the pCRII vector (Invitrogen, San Diego, Calif.) to yield plasmid pNA4. The nucleotide sequence was determined by the dideoxy sequencing method (40) by using a set of primers complementary to conserved regions located along the archaeal 16S rRNA. The sequence was aligned to a collection of archaeal 16S rRNA sequences (DNA Data Bank of Japan [DDBJ], National Institute of Genetics, Shizuoka, Japan). Numbers of base substitutions per site were estimated by the method of Tajima and Nei (45), and the phylogenetic tree was inferred on the basis of the neighborjoining method (36). The resulting tree was tested by using bootstrap analysis (14). Nucleotide sequence accession number. The 16S rRNA sequence of isolate K1 will appear in the DDBJ, EMBL, and GenBank nucleotide sequence databases with the accession number D83259.
D83259
pdf
Reassessment of the phylogenetic position of the bacterium associated with Whipple's disease and determination of the 16S-23S ribosomal intergenic spacer sequence -- Maiwald et al. 46 (4): 1078 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Preparation of DNA from biopsy material. DNA from the Whipple's disease bacterium was extracted from the duodenal biopsy of a patient whose case was previously reported (27). Prior to PCR, the biopsy was deparaffinized by shaking it twice in 1 ml of n-hexane and twice in 500 l of ethanol, each step lasting for 30 min. The sample was centrifuged for 5 min at 18,000 g between each of these steps. The biopsy was then dried under vacuum, subsequently digested for 2 h at 56 C in 40 l of lysis buffer (50 mM KCl, 10 mM Tris, 1.5 mM MgCl2, 1% Triton X-100, 200 g of proteinase K per ml), and boiled for 10 min after the addition of 20 l of a 20% Chelex suspension (biotechnology-grade chelating resin Chelex 100; Bio-Rad Laboratories, Richmond, Calif.). Ten microliters of the supernatant was added to the PCR. PCR amplification. The composition of the PCR mix was the same as described previously (26), and the cycling profile consisted of initial denaturation at 95 C for 3 min followed by 40 cycles of denaturation at 95 C for 45 s, annealing at 58 C for 1 min, extension at 72 C for 1 min, and final extension at 72 C for 2 min. To amplify a 1,249-bp fragment from the 16S rRNA gene, the universal bacterial primer p8FPL (5 -AGTTTGATCCTGGCTCAG) and the Whipple's disease bacterium-specific primer pW2RB (5 -ATTCGCTCCACCTTGCGA) of Relman et al. (36) were used in a modified version, both without restriction enzyme recognition sites. To obtain the 3 end of the 16S rRNA gene, the 5 end of the 23S rRNA gene and the intergenic spacer, the Whipple's disease bacterium-specific primer pW3FE (5 -AGAGATACGCCCCCCGCAA, without restriction sites) of Relman et al. (36), and the universal primer 2 for the 23S rRNA gene (5 -GGTACCTTAGATGTTTCAGTTC) of Kostman et al. (20) were used. PCR products were checked on 5% polyacrylamide gels with previously described electrophoresis conditions (26), subsequently transferred to nylon membranes, and hybridized at 60 C with the 32P-labeled oligonucleotide "whip3" (5 -TGGTACAGAGGGTTGCAATA), which is located on the 16S rRNA of the Whipple's disease bacterium between the primers pW3FE and pW2RB of Relman et al. (36). To obtain pure DNA for sequencing, electrophoresis was performed on 1% agarose gels. DNA fragments were cut out from the agarose gels and purified with the Jetsorb gel extraction kit (Genomed, Research Triangle Park, N.C.). Sequencing was performed with the AmpliCycle Sequencing Kit (Perkin-Elmer, Norwalk, Conn.) with incorporation of [ -33P]dATP. The reaction products were electrophoresed on 6% standard sequencing gels at constant power of 50 mA and then exposed to X-ray films. To confirm the results of manual sequencing, the reactions were repeated with the Taq DyeDeoxy Terminator sequencing kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer's protocol. The sequence reactions were then electrophoresed with the Applied Biosystems 373A DNA sequencer. Sequences were manually aligned with published sequences from members of the actinomycete line of descent. Phylogenetic analyses. The data set used for the phylogenetic analyses comprised 1,304 unambiguous nucleotides between positions 41 and 1449 (Escherichia coli numbering of positions). Phylogenetic analyses were carried out with the range of programs provided by the ARB ("a software environment for sequence data") (42), the PHYLIP package (7), and the Ribosomal Database Project (25). Phylogenetic trees were generated by the maximum-likelihood, neighbor-joining, least squares, and maximum-parsimony algorithms. The tree topologies were evaluated by bootstrap analyses with 1,000 resamplings of the sequence data with SEQBOOT (6). Nucleotide sequence accession numbers. The accession numbers of the sequences of the reference strains (strain designations given when available) used in the phylogenetic analyses are as follows: Actinoplanes philippinensis DSM 43019T (X93187), Agrococcus jenensis DSM 9580T (X92492), Agromyces ramosus DSM 43045T (X77447), Arthrobacter globiformis DSM 20124T (M23411), Atopobium minutum ATCC 33267T (M59059), Aureobacterium liquefaciens DSM 20638T (X77444), "Brevibacterium helvolum" DSM 20419 (X77440), Brevibacterium linens DSM 20425T (X77452), Cellulomonas biazotea DSM 20112T (X83802), Cellulomonas cellasea DSM 20118T (X83804), Cellulomonas cellulans DSM 43879T (X83809), Cellulomonas fermentans DSM 3133T (X83805), Cellulomonas flavigena DSM 20109T (X83799), Cellulomonas gelida DSM 20111T (X83800), Cellulomonas hominis CE40 (X82598), Clavibacter michiganense subsp. michiganense DSM 46364T (X77435), Clavibacter xyli subsp. cynodontis (M60935), "Corynebacterium aquaticum" DSM 20146 (X77450), Curtobacterium citreum DSM 20528T (X77436), Dermacoccus nishinomiyaensis DSM 20448T (X87757), Jonesia denitrificans DSM 20603T (X83811), Kocuria rosea DSM 20447T (X87756), Lentzea albidocapillata DSM 44073T (X84321), Microbacterium lacticum DSM 20427T (X77441), Micrococcus luteus (M38242), Nesterenkonia halobia DSM 20541T (X80747), Nocardia asteroides DSM 43757T (X80606), Promicromonospora enterophila DSM 43852T (X83807), Rathayibacter rathayi DSM 7485T (X77439), Rothia dentocariosa ATCC 17931T (M59055), Sporichthya polymorpha DSM 46113T (X72377), Streptomyces griseus (M76388), and Streptosporangium roseum DSM 43021T (X89947). The sequence determined for the Whipple's disease bacterium in this study and the structural features associated with it have been deposited in the EMBL database under accession no. X99636.
X93187 X92492 X77447 M23411 M59059 X77444 X77440 X77452 X83802 X83804 X83809 X83805 X83799 X83800 X82598 X77435 M60935 X77450 X77436 X87757 X83811 X87756 X84321 X77441 M38242 X80747 X80606 X83807 X77439 M59055 X72377 M76388 X89947 X99636
pdf
Phylogenetic relationships of the genera Acetobacterium and Eubacterium sensu stricto and reclassification of Eubacterium alactolyticum as Pseudoramibacter alactolyticus gen. nov., comb. nov -- Willems and Collins 46 (4): 1083 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Bacterial strains studied. Acetobacterium bakii DSM 8239T (T type strain), Acetobacterium carbinolicum DSM 2925T, Acetobacterium fimetarium DSM 8238T, Acetobacterium malicum DSM 4132T, Acetobacterium paludosum DSM 8237T, Acetobacterium wieringae DSM 1911T, Acetobacterium woodii DSM 1030T, and Eubacterium callanderi DSM 3662T were obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany. 16S rRNA gene amplification and sequencing. Lyophilized cells obtained from a culture collection ampoule were suspended in 500 l of TES buffer (0.05 M Tris-HCl, 0.005 M EDTA, 0.05 M NaCl; pH 8.0), and the DNA was extracted by using the procedure of Lawson et al. (11). The almost complete 16S rRNA gene (Escherichia coli positions 31 to 1420) was then amplified by PCR by using primers ARI (5 -GAGAGTTTGATCCTGGCTCAGGA-3 ) and pH (5 -AAG GAGGTGATCCAGCCGCA-3 ). The PCR products were purified by using a Prep-A-Gene kit (Bio-Rad, Hercules, Calif.) according to the manufacturer's instructions and were sequenced directly by using an ABI PRISM DNA sequencing kit (Perkin Elmer, Foster City, Calif.) and a model 373A automatic DNA sequencer (Applied Biosystems, Inc., Foster City, Calif.). Phylogenetic analysis. Analyses were performed by using the sequence analysis programs in the Genetics Computer Group package (6) and the phylogeny inference package PHYLIP (9). The program FASTA (6) was used to determine which sequences in the EMBL data library were most similar to the new Acetobacterium sequences. These data were then retrieved from the EMBL data library and included in a phylogenetic analysis together with our new data and a selection of sequence data for other taxa obtained from the EMBL data library. A multiple-sequence alignment was prepared with the program LOCALPILEUP (6) and was corrected manually. Approximately the first 100 bases were omitted from further analyses because of alignment ambiguities in the hypervariable region. In all, 1,309 positions were used for distance calculations. A distance matrix in which the Kimura-2 parameter was used was prepared with the programs PRETTY (6) and DNADIST (9), and a phylogenetic tree was constructed by using the neighbor-joining method and the program NEIGHBOR (9). To assess the statistical significance of the groups, a bootstrap analysis (500 replications) was performed by using the programs SEQBOOT, DNADIST, NEIGHBOR, and CONSENSE (9). The sequence similarity values given below and in Table 1 were calculated by using the program GAP (6). Nucleotide sequence accession numbers. The 16S rRNA gene sequences of the type strains of the seven Acetobacterium species and Eubacterium callanderi have been deposited in the EMBL data library under accession numbers X96954 to X96961.
X96954 X96961
pdf
The genus Nocardiopsis represents a phylogenetically coherent taxon and a distinct actinomycete lineage: proposal of Nocardiopsaceae fam. nov -- Rainey et al. 46 (4): 1088 -- International Journal of Systematic and Evolutionary Microbiology
contained information for 1,236 unambiguous nucleotide positions present in all sequences between positions 51 and 1471 (Escherichia coli numbering [1]). When only the Nocardiopsis sequences generated in this study and the sequence of Microtetraspora glauca were used, a second data set, which contained information for 1,437 unambiguous nucleotide positions present in these sequences between positions 34 and 1500 (E. coli numbering [1]), was produced. Evolutionary distances were calculated by the method of Jukes and Cantor (11). Phylogenetic dendrograms were reconstructed by using treeing algorithms contained in the PHYLIP package (6). Tree topologies were evaluated by performing bootstrap analyses (5) of the neighbor-joining data, using 1,000 resamplings. Saponification, methylation, extraction, and analysis of fatty acid methyl esters. Fatty acid methyl esters were obtained from wet biomass (ca. 40 mg) by saponification, methylation, and extraction (15). The fatty acid methyl ester mixtures were separated by using a model 5898A microbial identification system apparatus (Microbial ID, Newark, Del.). The fatty acid data obtained for the strains were compared qualitatively and quantitatively by using Ward's method (26) and the Microbial Identification System Library Generation software (Microbial ID, Newark, Del.). Nucleotide sequence accession numbers. The 16S rDNA sequences determined in this study have been deposited in the EMBL data library under the accession numbers shown in Table 1. The accession numbers of the sequences of the strains used as representatives of the main actinomycete groups are as foltype strain), X93187; Arthlows: Actinoplanes philippinensis DSM 43019T (T robacter globiformis DSM 20124T, M23411; Atopobium minutum ATCC 33267T, M59059; Bifidobacterium bifidum ATCC 29521T, M38018; Cellulomonas flavigena DSM 20109T, X83799; Dactylosporangium aurantiacum DSM 43157T, X93191; Microbacterium lacticum DSM 20427T, X77441; Microlunatus phosphovorus JCM 9379T, D26169; Micromonospora chalcea DSM 43026T, X92549; Mycobacterium tuberculosis NCTC 7416T, X58890; Nocardia asteroides DSM 43757T, X80606; Nocardioides albus DSM 43109T, X53211; Propionibacterium freudenreichii DSM 20271T, X53217; Saccharopolyspora rectivirgula ATCC 33515T, X53194; Saccharothrix australiensis ATCC 31497T, X5192; Sporichthya polymorpha DSM 46113T, X72377; Streptomyces ambofaciens ATCC 23877T, M27245; Streptomyces griseus NCTC 9080, X61478; Streptosporangium longisporum DSM 43180T, X89944; and Streptosporangium roseum DSM 43021T, X89947.
X93187 M23411 M59059 M38018 X83799 X93191 X77441 D26169 X92549 X58890 X80606 X53211 X53217 X53194 X72377 M27245 X61478 X89944 X89947
pdf
Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group -- Pettersson et al. 46 (4): 1093 -- International Journal of Systematic and Evolutionary Microbiology
products were immobilized onto streptavidin-coated super paramagnetic beads (Dynabeads M-280 streptavidin [Dynal AS, Oslo, Norway]), and the strands were separated as described previously (7, 8, 15, 16, 23). Both strands were used for sequencing. The sequencing primers were labeled with the indodicarbocyanine dye ALFred (Cy5) phosphoramidite (Pharmacia Biotech, Uppsala, Sweden) for detection with the red laser-based automated laser fluorescent DNA sequencing system ALFexpress (Pharmacia Biotech). The sequences and positions of the sequencing primers are listed in Table 2. All sequencing primers were purified by reverse-phase liquid chromatography and kindly provided by Pharmacia Biotech. One picomole of the sequencing primer was used in the sequencing reactions. DNA sequencing with the ALFexpress electrophoresis unit. The gel cassette was assembled with continuous glass spacers with a thickness of 0.3 mm (thin gel). Fifty milliliters of a gel solution consisting of 5% Hydro-Link in 1.5 Tris-borate-EDTA was prepared from 50% Hydro-Link Long Ranger Gel Solution (AT Biochem, Malvern, Pa.). Polymerization was achieved by addition of 25 l of N,N,N ,N -tetramethylethylenediamine and 250 l of 10% ammonium persulfate. The Sanger fragments were separated by electrophoresis at 45 C with 0.5 Tris-borate-EDTA as running buffer. The experimental conditions were 1,500 V, 38 mA, and 20 W. The sequence was monitored on-line. Analysis of 16S rRNA sequences. The 16S rRNA sequences from the ruminant mycoplasmas determined in this work were manually aligned with a selection of 16S rRNA sequences from Mycoplasma species, which were retrieved from the data bank of the Ribosomal RNA Database Project (11). Two different alignments were performed. One was composed of representatives of the hominis group, and the other consisted of sequence data from members belonging to the pneumoniae group. A secondary structure model of the 16S rRNA molecule of Mycoplasma hyopneumoniae (6) was used for identification of stem and loop regions in the alignment procedure. The alignments were corrected for ambiguously aligned positions. The phylogenies were inferred by using the neighborjoining program (NEIGHBOR) of Saitou and Nei (19) contained in the Phylogenetic Inference Package, PHYLIP version 3.51c (5). Bootstrap analysis was performed in a set of 500 resamplings with the SEQBOOT program. The similarity matrices were corrected for multiple base changes at single locations by the method of Jukes and Cantor (9). Nucleotide sequence accession numbers. The sequences of the 16S rRNA
M24290 U04656 U02968 U04655 U04646 U44763 U44764 U44765 U44766 U44767 U44768 U44769 U44770 U44771
pdf
Rhodothermus obamensis sp. nov., a modern lineage of extremely thermophilic marine bacteria -- Sako et al. 46 (4): 1099 -- International Journal of Systematic and Evolutionary Microbiology
immediately. Micrographs were taken with a Nikon optishot microscope equipped with a Nikon FX-II camera system. Determination of growth. Growth of the new isolate was determined by measuring turbidity at 660 nm and by direct cell counting after preparations were stained with 4 ,6-diamidino-2-phenylindole. Duplicate cultures were grown in 300-ml flasks containing 100 ml of medium in a temperature-controlled dry oven (Advantec, Tokyo, Japan) and were shaken at 100 rpm. The growth curves under changing pH and NaCl concentration conditions were determined at 75 C. Organic substrates for growth. To find organic substrates which supported growth of the new isolate, experiments were conducted in MJ medium containing potential substrates in place of yeast extract and peptone. The potential substrates were added at concentrations of 0.01, 0.05, and 0.1% (wt/vol). Cells were precultured in each medium and inoculated into the same medium. Duplicate tests were performed at 75 C. Cellular fatty acid and quinone compositions. Cellular fatty acid and quinone compositions were determined by using OKD7T cells cultivated in Jx medium at 75 C. The cellular fatty acid content was determined as described by Kawasumi et al. (14), while the major quinone content was determined as described by Ishii et al. (12). Isolation and base composition of DNA. DNA was prepared as described by Marmur and Doty (19) and Lauerer et al. (18). The G C content of the DNA was determined by directly analyzing the deoxyribonucleotides by high-performance liquid chromatography (27). A DNA GC kit (Yamasa, Chiba, Japan) was used as the standard. Amplification of 16S rRNA gene and sequence determination. The 16S rRNA gene was amplified by the PCR. The sequences of the primers used for amplification were 5 -AGAGTTTGATCCTGGCTCAG-3 and 5 -GGTTACCTTCC TCCGGCTTA-3 , corresponding to positions 8 to 27 and 1492 to 1511, respectively, in the 16S rRNA sequence of Escherichia coli (6). The 1.5-kb PCR product was directly sequenced by the dideoxynucleotide chain termination method by using a model 373As DNA sequencer (Applied Biosystems, Inc.). The DNA sequence data were used in a sequence homology search with previously described 16S rRNA sequences by using DNASIS software (Hitachi Software, Tokyo, Japan). Data analysis. The almost complete 16S rRNA sequence of OKD7T was aligned with other sequences, and the evolutionary distances (Knuc values) were calculated by using 1,407 nucleotides (corresponding to position 29 to position 1436 on the E. coli 16S rRNA sequence). The ODEN version 1.1.1 software package (National Institute of Genetics, Mishima, Japan) was used to align multiple sequences, to calculate the Knuc values, and to construct a phylogenetic tree based on the results of the neighbor-joining method (24) and a bootstrap examination. Nucleotide sequence accession number. The almost complete 16S rRNA sequence of strain OKD7T has been deposited in the EMBL nucleotide sequence database under accession number X95071.
X95071
pdf
Organization and phylogenetic interrelationships of genes encoding components of the botulinum toxin complex in proteolytic Clostridium botulinum types A, B, and F: evidence of chimeric sequences in the gene encoding the nontoxic nonhemagglutinin component -- East et al. 46 (4): 1105 -- International Journal of Systematic and Evolutionary Microbiology
MATERIALS AND METHODS Bacterial strains and plasmids. Genomic DNA was prepared from the clostridial strains listed in Table 1 according to the method described by Lawson et al. (23). Escherichia coli One Shot obtained from Invitrogen (R&D Systems, Cowley, United Kingdom) was used as the recipient for cloning. PCR and cloning. PCR was carried out with Perkin-Elmer Ampli-Taq DNA polymerase (Applied Biosystems, Warrington, United Kingdom) as described previously (6) according to the scheme outlined in Fig. 1. The sequences of primers used are given in Table 2. PCR products were cloned with a TA cloning kit (Invitrogen) as described previously (6). Hybridization analysis. Hybridizations were carried out with an ECL kit (Amersham International, Amersham, United Kingdom) according to the manufacturer's instructions. Slot blots were performed essentially as described by Campbell et al. (2), with hybridization carried out at 42 C and washing carried out at 50 C. The oligonucleotide hybridization probes used are listed in Table 2. DNA sequencing. Double-stranded DNA was sequenced as described previously (2) with a U.S. Biochemicals Sequenase kit (Amersham) according to the manufacturer's instructions. Clones obtained from two separate PCRs were sequenced, and, in the case of discrepancy, a third independent clone was analyzed. Analysis of data. Analysis was performed with the molecular biology software of University of Wisconsin Genetics Computer Group package (5). The neighbor-joining method described by Saitou and Nei (27) was used for construction of the phylogenetic trees. The stability of trees was assessed by bootstrap analysis (11). Bootstrap values were calculated from 250 replicates. Nucleotide sequence accession numbers. The sequences presented here have been given EMBL/GenBank accession numbers as follows: NTNH gene sequences from strains 62A, Kyoto-F, and NCTC 7273, respectively, X92973, X87974, and X78230; P-21-NTNH gene sequences from strains Kyoto-F and Langeland, respectively, X96493 and X96494; P-21 partial gene sequences from strains Chiba-H and NCTC 9837, respectively, X96491 and X96492.
X92973 X87974 X78230 X96493 X96494 X96491 X96492
pdf
Thermococcus fumicolans sp. nov., a new hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent in the north Fiji Basin -- Godfroy et al. 46 (4): 1113 -- International Journal of Systematic and Evolutionary Microbiology
16S rRNA gene sequence analysis. The rrs gene was amplified by the PCR (41) as described previously (9) except that "archaean"-specific primers were used. The PCR products were cloned into pUC18 vectors by using a SureClone ligation kit (Pharmacia, Uppsala, Sweden) and were subcloned as HindIII-EcoRI insertions into M13mp18 and M13mp19 vectors. Both strands of one clone were sequenced by the dideoxy chain termination method (43), except that we used a HotTub DNA sequencing kit to resolve numerous compressions observed when genes of hyperthermophilic microorganisms were sequenced. PCR products were also directly sequenced by using a cycle sequencing kit (type CSDS; Gibco BRL, Gaithersburg, Md.) and 32P-labelled primers (Amersham). A total of 1,309 bp were sequenced. The sequences which we determined were then aligned with a representative collection of reference 16S rRNA sequences. A multiple alignment, a phylogenetic tree, and levels of similarity were obtained by using the MegAlign program of the DNASTAR package (Promega, Madison, Wis.) (Clustal method with weighted residue, weight table PAM 250) and the neighbor-joining method (42). Quantitative DNA-DNA hybridization. The DNAs of the Thermococcus celer and "Thermococcus litoralis" reference strains were used as labelled probes. Up to 20 liters of a culture were needed to get enough DNA for the experiment. A 4- to 5- g portion of each reference strain DNA was labelled by incorporating both [3H]dATP and [3H]dGTP with a Megaprime kit (Amersham). The nuclease S1 method of quantitative DNA-DNA hybridization was performed as described by Popoff and Coynault (38) on type DE81 filters (Whatman International, Maidstone, United Kingdom) by using a matic IV scintillation counter (Kontron Instruments, Montigny le Bretonneux, France). Nucleotide sequence accession number. The nucleotide sequence of the 16S rRNA of strain ST557T has been deposited in the GenBank database under accession number Z70250.
Z70250
pdf
Eubacterium exiguum sp. nov., isolated from human oral lesions -- Poco et al. 46 (4): 1120 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Isolation and characterization of a new gram-negative, acetone- degrading, nitrate-reducing bacterium from soil, Paracoccus solventivorans sp. nov -- Siller et al. 46 (4): 1125 -- International Journal of Systematic and Evolutionary Microbiology
L1 used only ribose, gluconate, and a few alcohols, ketones, and fatty acids. It could utilize 5 of 16 tested amino acids, but it could not use methylamines, the typical substrate of P. kocurii (32). Thus, strain L1 was significantly different from other acetone-degrading bacteria. Strain L1 clustered within the paracoccus group of the alpha subclass of the Proteobacteria in the vicinity of P. kocurii (Fig. 5). However, the most closely related Paracoccus strains have a very distinct spectrum of substrates. The DNA-DNA similarity to T. pantotropha is less than 70%. Thus, strain L1 is considered to represent a new species, Paracoccus solventivorans sp. nov. Description of Paracoccus solventivorans sp. nov. Paracoccus solventivorans (sol.ven.ti.vo .rans, M. L. neut. n. solventum, solvent; L. part. pres. vorans, eating; M. L. solventivorans, solvent eating). This organism has a gram-negative cell wall architecture, but the gram stain reaction is variable. Cells are coccoid or rodlike, 0.4 to 0.5 by 0.9 to 1.5 m. The bacterium is non-spore forming and nonmotile. Light-scattering PHB inclusions are evident. The murein lacks DAP. The optimum growth temperature is 30 to 37 C; the optimum pH is 7 to 8. NaCl is inhibitory at concentrations 0.2%. No vitamin addition is required. The electron acceptors are oxygen and nitrate. N2 is produced from nitrate via respiration. Acetone is oxidized to CO2 and metabolized to PHB. Besides acetone, 2-butanone, 2-propanol, fumarate, succinate, gluconate, glutamate, aspartate, asparagine, -ketoglutarate, isoleucine, glycine, ribose, propionate, n-butyrate, 3-hydroxybutyrate, acetoacetate, Casamino Acids, gluconate, and pyruvate could serve as carbon sources. Many other substances are not utilized. Acetone is degraded via acetoacetate. The G C content of the DNA is 68.5 mol% (as determined by HPLC) or 70 mol% (as determined by Tm). This organism is a member of the alpha subgroup of proteobacteria (paracocci group) according to the results of phylogenetic analysis. It has been deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession number DSM 6637. Nucleotide sequence accession number. The sequence of the gene coding for the 16S rRNA has been deposited in the EMBL under the accession number Y07705.
Y07705
pdf
Thermosyntropha lipolytica gen. nov., sp. nov., a lipolytic, anaerobic, alkalitolerant, thermophilic bacterium utilizing short- and long-chain fatty acids in syntrophic coculture with a methanogenic archaeum -- Svetlitshnyi et al. 46 (4): 1131 -- International Journal of Systematic and Evolutionary Microbiology
Biosystem model 373A DNA sequencer. The 16S rDNA sequences of the three strains were manually aligned with previously published 16S rRNA/rDNA sequences of representatives of the clostridia and related taxa. The method of Jukes and Cantor (18) was used to calculate evolutionary distances from which a phylogenetic dendrogram was reconstructed according to the algorithm of De Soete (6). Nucleotide sequence accession number. The 16S rRDA sequence of strain JW/VS-265T has been deposited in the EMBL database under the accession no. X99980.
X99980
pdf
DNA relatedness among Pseudomonas strains isolated from natural mineral waters and proposal of Pseudomonas veronii sp. nov -- Elomari et al. 46 (4): 1138 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Clostridium ultunense sp. nov., a mesophilic bacterium oxidizing acetate in syntrophic association with a hydrogenotrophic methanogenic bacterium -- Schnurer et al. 46 (4): 1145 -- International Journal of Systematic and Evolutionary Microbiology
in 0.1 SSC (pH 7) (1 SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Thermal denaturation curves were determined with a model DU 650 spectrophotometer (Beckman Instruments, Inc., Fullerton, Calif.). DNAs from Lactobacillus reuteri (G C content, 41 mol%) (2) and Lactobacillus sp. strain 11739 (G C content, 53 mol%) (16) were used as controls. The G C content was determined by using the formula of Schildkraut and Lifson (37): G C content 2.08Tm 106.4 (for 0.1 SSC), where Tm is the temperature at the midpoint of the sigmoidal curve. High-resolution NMR. Cells were grown in 1 liter of MRCM containing 10 mM cysteine (optical density at 600 nm, 0.25), centrifuged at 4 C and 12,500 g for 30 min, and washed with BM. The cell pellet was finally resuspended in 5 ml of BM containing 5% D2O to provide a lock signal. Precipitated FeS was allowed to settle as described by Houwen et al. (13) to avoid peak broadening in the nuclear magnetic resonance (NMR) spectra. A 2.8-ml portion of the supernatant was transferred to a 10-ml NMR tube. The tube was sealed with a butyl rubber stopper, and the gas phase was changed to N2-CO2. All cell transfers and washing procedures were performed in an anoxic glove box with an H2-N2 (5:95) gas phase (Coy Laboratory Products, Inc.). At time zero, 0.16 ml of L-[3-13C]cysteine (99% enriched) was added with a syringe to give a final concentration of 10 mM. 13C-NMR spectra were obtained at 101 MHz with a Varian model VRX 400 instrument operated at 37 C. Eleven runs were made over a period of 11 h, and each run contained 1,000 transients. The pulse width was adjusted to 45 (13 s) with a repetition time of 5.6 s, and a walz modulator was used for broadband decoupling. Cocultivation experiments. Cocultivation experiments were performed with isolates SAR1 and TRX1 by using BM with and without yeast extract and, in most cases, with and without NH4Cl (0.2 M). The pH of the medium was adjusted to 7.5 to 8.0, and the cultures were incubated at 37 C without shaking. The hydrogen-consuming organisms used in the experiments were Methanococcus deltae DSM 2771, Methanogenium olentangyi DSM 2772, Methanoplanus limicola DSM 2279, Methanobrevibacter arboriphilus DSM 744, Desulfovibrio vulgaris DSM 644, Wolinella succinogenes DSM 1740, and methanogenic isolate MAB1 (41) from the triculture. All of the methanogenic strains used were halotolerant, and all could grow in the presence of 0.2 M ammonium chloride. Two types of cultivation were performed in all experiments: (i) isolates SAR1 and TRX1 and the hydrogen-consuming organism were grown separately on medium containing cysteine (10 mM), on medium containing glucose (10 mM), and in the presence of H2-CO2 (80:20), respectively. Either SAR1 or TRX1 or both SAR1 and TRX1 were transferred to the actively growing culture of the hydrogen-consuming organism once exponential growth had started. (ii) SAR1 or TRX1 or both SAR1 and TRX1 and the hydrogen-consuming organism were transferred to a new bottle containing fresh medium. The coculture experiments in which isolate BST was used were performed in BM (pH 7.4, 37 C) reduced with either sodium sulfide and cysteine or sodium sulfide and sodium dithionite. Cells growing exponentially on ethylene glycol were transferred to actively growing cultures of methanogenic isolate MAB1. The gas phase (H2-CO2, 80:20) of the latter culture was replaced by N2-CO2 (80:20), and sodium acetate was added to a final concentration of 50 mM before the nonmethanogenic isolates (SAR1, TRX1, BST) were transferred to the culture containing the hydrogen-consuming organism. Nucleotide sequence accession number. The nucleotide sequence of strain BST 16S rDNA has been deposited in the EMBL Nucleotide Sequence Database under accession number Z69293.
Z69293
pdf
Chrysiogenes arsenatis gen. nov., sp. nov., a new arsenate-respiring bacterium isolated from gold mine wastewater -- Macy et al. 46 (4): 1153 -- International Journal of Systematic and Evolutionary Microbiology
Nucleotide sequence accession number. The sequence determined in this study for BAL-1T has been deposited in EMBL under the accession number X81319.
X81319
pdf
Lactobacillus curvatus subsp. curvatus subsp. nov. and Lactobacillus curvatus subsp. melibiosus subsp. nov. and Lactobacillus sake subsp. sake subsp. nov. and Lactobacillus sake subsp. carnosus subsp. nov., new subspecies of Lactobacillus curvatus Abo-Elnaga and Kandler 1965 and Lactobacillus sake Katagiri, Kitahara, and Fukami 1934 (Klein et al. 1996, emended descriptions), respectively -- Torriani et al. 46 (4): 1158 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Determination of mycobacterial phylogeny on the basis of immunological relatedness of superoxide dismutases -- Shivannavar et al. 46 (4): 1164 -- International Journal of Systematic and Evolutionary Microbiology
pdf
Phylogeny of Methanopyrus kandleri based on methyl coenzyme M reductase operons -- Nolling et al. 46 (4): 1170 -- International Journal of Systematic and Evolutionary Microbiology
methanogens established previously on the basis of their 16S rRNA sequences. The position of Methanopyrus kandleri is particularly interesting for methanogen phylogenetics (26). Methanopyrus kandleri has the most divergent 16S rRNA sequence, genomic DNA with an unusually high G C content (60 mol%), and the highest known optimum growth temperature (98 C) and grows at temperatures up to 110 C (3, 13, 19). These features suggest that the lineage of this organism diverged very early from the other methanogen lineages, but Methanopyrus kandleri is nevertheless a methanogen. It should therefore have a phylogenetically informative MR operon, and in this paper we describe the cloning, sequence, and results of a phylogenetic analysis of the Methanopyrus kandleri mcr operon. The data obtained in this study also provide evidence that unusual codon usage occurs and that mRNA-tRNA base pairing is used in Methanopyrus kandleri cells to direct translation initiation at temperatures up to 110 C. On the basis of the highly conserved sequences (33) used as hybridization probes for mcrB and mrtB transcripts (24), we designed and used GC-rich primers to PCR amplify a 133-bp region from within the Methanopyrus kandleri mcrB and/or mrtB genes. Molecules from the pool of amplified DNA were cloned into pUC19, and several molecules were sequenced (28), which confirmed that they were identical and were from a mcrB gene. Southern blot hybridizations (28) with Methanopyrus kandleri genomic DNA revealed that the PCR-amplified region was located within an 15-kbp EcoRI fragment, and a -gt11 recombinant phage that contained this fragment intact was identified, by plaque hybridization (28), in a Methanopyrus kandleri genomic library. This EcoRI fragment was subcloned, and from the resulting subclone and additional subclones we sequenced the MR-encoding genes and flanking regions. The sequence obtained (GenBank accession number U57340) contained open reading frames consistent with the presence of a standard mcrBDCGA operon located upstream from an mtrE gene (Fig. 1A). In other methanogens, the mtrE
U57340
pdf
Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences -- Kuhnert et al. 46 (4): 1174 -- International Journal of Systematic and Evolutionary Microbiology
a The numbers indicate the positions relative to the E. coli rrs sequence (accession number J01859). b All of the primers except UNI16S-R, which was obtained from the C. botulinum sequence, are universal to clostridia and E. coli, as determined by rrs comparisons.
J01859
pdf
Phylogenetic relationships of the porcine mycoplasmas Mycoplasma hyosynoviae and Mycoplasma hyopharyngis -- Blank et al. 46 (4): 1181 -- International Journal of Systematic and Evolutionary Microbiology
the possibility of transmission through agricultural contact cannot be ruled out. It would be interesting to examine nondomesticated relatives of the pig to see if they are colonized by these or related mollicutes. Nucleotide sequence accession numbers. The nucleotide sequences of M. hyosynoviae and M. hyopharyngis determined in this study have been deposited in the GenBank database under accession numbers U26730 and U58997, respectively.
U26730 U58997
pdf
Ureaplasma gallorale, an isolate from chickens, is most closely related to the human isolate, U. urealyticum -- Stemke and Robertson 46 (4): 1183 -- International Journal of Systematic and Evolutionary Microbiology
Department of Biological Sciences and Department of Medical Microbiology and Immunology,2 University of Alberta, Edmonton, Alberta Canada Ureaplasma gallorale is a urease-containing mycoplasma (a member of the Mollicutes) which is pathogenic for chickens, from which it was originally isolated. We amplified the 16S rRNA gene of this bacterium and then cloned and sequenced the amplicon. A phylogenetic analysis based on an alignment of the 16S rRNA sequences of U. gallorale and several other Ureaplasma species revealed that U. gallorale is more closely related to Ureaplasma urealyticum than to other Ureaplasma species. The members of the Mollicutes (trivial name, mycoplasmas) are eubacteria that lack cell walls. These minimal organisms have small genomes with low G C contents and are considered phylogenetically related to the streptococcus-lactobacillus group of walled bacteria (8). Some members of the family Mycoplasmataceae contain the enzyme urease; these organisms are classified in the genus Ureaplasma. At this time, there are six named Ureaplasma species. The five Ureaplasma species which have been isolated from animals are Ureaplasma urealyticum, which was isolated from humans (7); Ureaplasma diversum, which was isolated from cattle (4); Ureaplasma cati and Ureaplasma felinum, which were isolated from cats (2); and Ureaplasma canigenitalium, which was isolated from dogs (3). The 16S rRNA sequences of the following two representatives of the two biovars of U. urealyticum have been published previously: strain T960 (GenBank accession number M23935) (8) and strain 27 (accession number L08642) (6). The sequences of the following species obtained from nonhuman animal hosts were recently deposited in the GenBank database by R. Harasawa: U. diversum (accession number D78650), U. cati (D78649), U. felinum (D78651) and U. canigenitalium (D78648). The sixth Ureaplasma species, Ureaplasma gallorale, was isolated from chickens (5), in which it is a significant pathogen. The 16S rRNA gene sequence of this organism was determined in this study. We amplified most of the 16S rRNA gene of U. gallorale by using primers for conserved 5 and 3 regions of members of the Mollicutes (1) and incorporating the XhoI site in the 5 primer and the PstI site in the 3 primer. After appropriate digestion the amplified ribosomal DNA was ligated to XhoIand XbaI-digested pBlueScript-SK (Stratagene, La Jolla, Calif.) and selected on the basis of ampicillin resistance and plasmid size (6). The sequence of the insertion was determined by a combination of manual sequencing (double-stranded sequencing, using dideoxy terminators [Pharmacia, Uppsala, Sweden]) and automatic cycle sequencing (Applied Biosystems, Foster City, Calif.); both strands were sequenced. The 1,515-bp sequence between the primers which we determined represents about 95% of the total 16S rRNA. Using 1,200 nucleotides (a limitation of the computer program) of the Ureaplasma sequences and the Mycoplasma pneumoniae sequence (GenBank accession number M29061), we obtained a multiple alignment with the Clustal computer program and prepared a dendrogram (Fig. 1). The 16S rRNA sequences of all six Ureaplasma species exhibited high levels of homology ( 94%) and thus are closely related. The Ureaplasma species isolated from single host species (the biovar representatives U. urealyticum T960 and U. urealyticum 27 isolated from humans and U. cati and U. felinum isolated from felines) were phylogenetically related pairs. However, beyond these pairs, there was no correlation between strain and host relatedness. U. gallorale, the species that is most closely related to U. urealyticum, is found in poultry, the host that is the greatest evolutionary distance from humans. Colonization of hosts by mollicutes appears to have occurred independently more than once and not to have closely followed host evolution. The very large database of 16S rRNA sequences allows rapid access to phylogenetic relationships. However, relationships based entirely on 16S rRNA sequences should be considered tentative until other conserved genes, such as those involved in DNA replication or the signature urease complex, are examined. In the meantime, it may be rewarding to seek ureaplasmas from more varied hosts, especially nondomesticated animals and birds.
M23935 L08642 D78650 D78649 D78651 D78648 M29061
pdf